ID: 1150168446

View in Genome Browser
Species Human (GRCh38)
Location 17:62966497-62966519
Sequence CCGCCGCCGAGCCGAGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150168435_1150168446 18 Left 1150168435 17:62966456-62966478 CCTCCCGGCTGTGCCGCGCGCTA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1150168441_1150168446 5 Left 1150168441 17:62966469-62966491 CCGCGCGCTAGGCGGAGCGAGGC 0: 1
1: 0
2: 1
3: 4
4: 60
Right 1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1150168434_1150168446 29 Left 1150168434 17:62966445-62966467 CCTCGCGCTCACCTCCCGGCTGT 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1150168437_1150168446 15 Left 1150168437 17:62966459-62966481 CCCGGCTGTGCCGCGCGCTAGGC 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1150168433_1150168446 30 Left 1150168433 17:62966444-62966466 CCCTCGCGCTCACCTCCCGGCTG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1150168438_1150168446 14 Left 1150168438 17:62966460-62966482 CCGGCTGTGCCGCGCGCTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150168446 Original CRISPR CCGCCGCCGAGCCGAGCCGA GGG Intergenic
903390959 1:22963318-22963340 CCCCAGCCGAGCCGAGCCGGGGG + Intronic
905369296 1:37474688-37474710 CGGGGTCCGAGCCGAGCCGAGGG + Intronic
905862545 1:41361199-41361221 CCGCCTCCGCGCCGAGCAGGGGG + Intergenic
907136252 1:52142158-52142180 GCGCCGCCGAGCCGGGCCGGGGG - Exonic
914265838 1:146037824-146037846 CCGCCGCCCAGCGGAGCGGGTGG + Intergenic
917920115 1:179743775-179743797 CTGCCCCCGGGCCGTGCCGAAGG + Intronic
1064372137 10:14761881-14761903 CCGCCACCGCACCGGGCCGATGG + Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1077541229 11:3147401-3147423 CCGCAGCCGAGGCCAGCCCATGG + Intronic
1083258133 11:61508916-61508938 CCGCCCCCCAGCCGCCCCGACGG - Exonic
1089543686 11:119206365-119206387 TCGCAGTCGAGCCGAGCCGGCGG + Exonic
1092843162 12:12562214-12562236 CCGCCGCGGAGCCGAGAGGGCGG + Exonic
1093972297 12:25386183-25386205 CCGCCGCCCTGCCGAGCCCGGGG + Intergenic
1098105955 12:67069297-67069319 CCGCCGCCGCCCGGAGCCGCCGG - Intergenic
1100632205 12:96400230-96400252 GCGCCGACGAGCCGCGCGGACGG + Exonic
1100632231 12:96400335-96400357 CCGCCGCAGAGCCGCGGAGAAGG - Exonic
1103488243 12:121296892-121296914 CCGGCGCAGGGCCGAGCCGGCGG - Intronic
1105472063 13:20703729-20703751 CCGCCGCCGCCCCGAGCCGGGGG - Intronic
1105472171 13:20704029-20704051 CTGCCGCCGAGCTGGGCCGCGGG + Exonic
1105725714 13:23160337-23160359 CCTGCGCCTAGCCGAGCCCAGGG - Intergenic
1106708952 13:32311284-32311306 CCGCCTCCGAGCCGCTCCGGAGG - Exonic
1113705136 13:112425422-112425444 CAGCGGCCGGGCCGAGCTGAGGG - Intronic
1115320524 14:32076150-32076172 CCCGTGCCGTGCCGAGCCGACGG + Intronic
1118404766 14:65412562-65412584 CCACCGCCTAGCAGAGCCGCGGG - Intronic
1122666615 14:103334442-103334464 CCGCCGCCGAGCAGCGGGGAGGG - Exonic
1132527694 16:425803-425825 CCGCCGCGCCGCCGGGCCGAGGG + Exonic
1138591319 16:58000937-58000959 CCTGCGCAGAGCCGGGCCGAGGG - Intronic
1139489681 16:67279606-67279628 ACGCCCCCGGGCCGAGCCGCGGG - Exonic
1142240048 16:88940920-88940942 CCGCAGCCGCGCCGAGCGCACGG - Intronic
1145261043 17:21355064-21355086 CCACCCCCAAGCCGAGCCCAGGG + Intergenic
1145938161 17:28726883-28726905 CCTCCGGGGAGCCGGGCCGAGGG - Intronic
1146052876 17:29567035-29567057 CCGCCGGCGGGCGGAGCCGCGGG - Exonic
1150168446 17:62966497-62966519 CCGCCGCCGAGCCGAGCCGAGGG + Intergenic
1151673911 17:75588457-75588479 CGGCGGCCCCGCCGAGCCGAGGG - Intergenic
1151729804 17:75904594-75904616 CCGGCGCCGAGCAGAGCAGGAGG - Exonic
1151783836 17:76265638-76265660 CCGCCGCGGGGCCGGGCCGCGGG + Intronic
1162113363 19:8413364-8413386 CCGGGGCCGAGGCGAACCGAGGG + Intronic
1163138718 19:15332154-15332176 CCGCCCCCGCGCCGCGCGGATGG + Intronic
1163583788 19:18153450-18153472 CCGCTGCGGAGCCGAGCCCGAGG - Intronic
1166807706 19:45496995-45497017 CCCCCGCCGAGCCGAGCACCAGG - Exonic
1167001155 19:46746358-46746380 CCGCGCCTGAGCCGAGCGGACGG + Exonic
1167134646 19:47609452-47609474 CCGCCGCCGCCCCGATCCTATGG + Intronic
933666709 2:84970823-84970845 CCGCCGCCGCGCCGCGCGTAGGG - Intergenic
933908055 2:86914269-86914291 CCGCCGCCCGGCCGAGGCCAAGG - Intronic
936410678 2:112255177-112255199 CCTGCGCAGAGCCGAGGCGAAGG - Intergenic
940918887 2:159286545-159286567 CCGCCGCTGAGCCGGCCCGTGGG + Exonic
949014582 2:241702192-241702214 CCGCCGCCCTCCCGAGCCCACGG - Intronic
1172661941 20:36574126-36574148 CCGCCGCCGAGCCGGACAGGGGG + Intronic
1172702958 20:36863744-36863766 GCGCCCCCGAGCCGAGGCGGCGG - Intergenic
1176223232 20:63979736-63979758 CCTCCGCGGAGCCGTGCCCAGGG - Intronic
1183363335 22:37394322-37394344 CAGCACCCGAGCCGAGCAGAGGG - Intronic
1183702163 22:39457104-39457126 CCGCCGCCGCGCCGGGCCGGGGG - Intergenic
1185055145 22:48575492-48575514 CCGGCGCCGAGCCGAGCGGGCGG + Intronic
953485061 3:43286884-43286906 CCGCCGCCAGGCCGCGCCGCGGG - Intronic
960664185 3:120094264-120094286 CGGGCACCGAGCAGAGCCGAGGG - Intronic
961698987 3:128726742-128726764 CCGCCGCCGTGCCCACCCGGCGG + Intronic
962809097 3:138946613-138946635 CCGCCGCCGAGCCCAGGCAAGGG - Exonic
968636663 4:1684425-1684447 CCTCAGCCGCGCCGCGCCGACGG + Intergenic
981093423 4:140756149-140756171 CCGCCGCCGCACCTAGCGGACGG - Intergenic
992487403 5:77210311-77210333 CCGCGGCGGAGCCGAGCCGCGGG + Intergenic
1002622075 5:180494832-180494854 CCGCGACCGAGCCCGGCCGACGG - Intronic
1002784987 6:393439-393461 CCGCCTCCGAGGCGAGCCCAGGG + Intronic
1005040194 6:21594516-21594538 CGCCCGCCGAGCCGAGGCCATGG + Exonic
1006472234 6:34235654-34235676 CCGCCTCCGCGCCGGGCCCAGGG + Intergenic
1006725474 6:36196728-36196750 CCGCCACGGAGCCCGGCCGAGGG - Exonic
1011702929 6:89972184-89972206 CCGCCGCCGAGGCTGGCCCAGGG + Intronic
1013155748 6:107490072-107490094 CCTCCCGCGAGCCGAGCCGGGGG - Exonic
1015149184 6:130019648-130019670 CGGCCGCCGAGCCCCGCCGCGGG - Intronic
1034418757 7:150978292-150978314 CCGCGGCCGGGCCGAGCCGCAGG - Exonic
1034468881 7:151245459-151245481 CCGCCCCCGCGCGGAGCCGCAGG - Exonic
1042155619 8:65841673-65841695 CCGCCGGCGGCCCGAGCGGAGGG - Exonic
1049622376 8:143604536-143604558 CCGCCGCCCAGCCTCGCTGAGGG + Exonic
1049973592 9:841905-841927 CCGCCGCAGGGCAGAGCCGGGGG + Exonic
1054798577 9:69325233-69325255 GCGGAGCGGAGCCGAGCCGAAGG - Intronic
1056386277 9:86099580-86099602 CCGCCCCCGAGCAGCGCCGGCGG + Intronic
1057312633 9:93951707-93951729 CGGCCTCCAGGCCGAGCCGACGG + Exonic
1061299655 9:129697369-129697391 CCGCCGCCCAGCTGCTCCGAGGG - Intronic
1192372463 X:70525942-70525964 CCCCCGCCGCGCCGAGGAGAAGG - Intergenic
1200133072 X:153862053-153862075 CCGCCGCCCAGCCCACCCCATGG - Exonic