ID: 1150171824

View in Genome Browser
Species Human (GRCh38)
Location 17:63004404-63004426
Sequence TTTGACACACATAGCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150171824_1150171827 0 Left 1150171824 17:63004404-63004426 CCAAGGTGGCTATGTGTGTCAAA No data
Right 1150171827 17:63004427-63004449 GTCAGGAAATCCTTCTTCCTGGG No data
1150171824_1150171829 10 Left 1150171824 17:63004404-63004426 CCAAGGTGGCTATGTGTGTCAAA No data
Right 1150171829 17:63004437-63004459 CCTTCTTCCTGGGAGCCAAGAGG No data
1150171824_1150171826 -1 Left 1150171824 17:63004404-63004426 CCAAGGTGGCTATGTGTGTCAAA No data
Right 1150171826 17:63004426-63004448 AGTCAGGAAATCCTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150171824 Original CRISPR TTTGACACACATAGCCACCT TGG (reversed) Intergenic
No off target data available for this crispr