ID: 1150172903

View in Genome Browser
Species Human (GRCh38)
Location 17:63018736-63018758
Sequence ATGGATTAGCAGTTATTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150172903 Original CRISPR ATGGATTAGCAGTTATTATC AGG (reversed) Intronic
905223218 1:36463267-36463289 ATATATTAGAATTTATTATCTGG - Intronic
909386978 1:75068612-75068634 CTGGAGTAGCAGGTATTATACGG - Intergenic
910569308 1:88682775-88682797 AAGGATTAGGAGTTCTTATCCGG - Intergenic
911784698 1:101931759-101931781 GTGGATTGCCAGTTATTATTAGG - Intronic
912554687 1:110507738-110507760 GTGAAATAGCATTTATTATCTGG + Intergenic
914956672 1:152168728-152168750 AGGGAATAGCAGTTCTTCTCAGG + Intergenic
916308058 1:163361888-163361910 ATGTGTTAGCAATTATTATGTGG + Intergenic
916607998 1:166362041-166362063 TTGGATTAGCAATTTTTTTCAGG - Intergenic
917651682 1:177084061-177084083 ATGTATTTGCAGATATTATAAGG - Intronic
919320110 1:196025703-196025725 CTGGATTATTAGTTGTTATCAGG + Intergenic
919416655 1:197319049-197319071 ATTTATTAGAAGATATTATCAGG - Intronic
919856861 1:201712103-201712125 AGGGATGAGCAGTCATTTTCTGG - Intronic
923349202 1:233087096-233087118 AGGGACTAGCCGTGATTATCAGG + Intronic
924395923 1:243620616-243620638 AAGTATTAGAAGTCATTATCTGG - Intronic
1064024005 10:11832490-11832512 ATGGATTACCTGTTAATATTGGG + Intronic
1064977470 10:21133657-21133679 ACATATTAGCTGTTATTATCAGG + Intronic
1068165704 10:53329824-53329846 ATGGATTACCAGTTCCTATCAGG + Intergenic
1068249413 10:54417727-54417749 ATGAATTAGTAGCAATTATCAGG - Intronic
1073601286 10:104848388-104848410 AAGTCTTAGCAATTATTATCAGG - Intronic
1074483723 10:113853369-113853391 ATGGAATAGCAGGTGTTGTCAGG - Exonic
1091112646 11:132984392-132984414 AAGGATTAGCACTTACTATCTGG + Intronic
1092644845 12:10559270-10559292 ATGGATTTTCAGTTCTTATGAGG - Intergenic
1105666474 13:22563633-22563655 TTGGAAAAGCAGATATTATCAGG + Intergenic
1107273885 13:38654844-38654866 AGGGATTAGCAGTAACTTTCTGG + Intergenic
1110355173 13:74559108-74559130 ATGGATTAGAGGTCATTATAAGG - Intergenic
1111223549 13:85239091-85239113 ATGGATTTGCAGTTATATTCAGG - Intergenic
1115689449 14:35827664-35827686 AGGGATAAATAGTTATTATCTGG + Intronic
1119269541 14:73290125-73290147 ATGGTTTTTAAGTTATTATCTGG + Intronic
1120376572 14:83715757-83715779 ATGGAGTAGAAGTTATAAACTGG - Intergenic
1124444640 15:29719245-29719267 ATGTTTTACCATTTATTATCAGG + Intronic
1125133372 15:36311251-36311273 ATGAATTATGAGTTATGATCTGG - Intergenic
1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG + Intronic
1129798937 15:78398818-78398840 ATTAATTAGCAGCTATTATTAGG - Intergenic
1129875512 15:78973120-78973142 ATTGATGAGCAGTTAGAATCTGG - Intronic
1132237663 15:100234193-100234215 ATGGATTAGAAGTGTGTATCGGG + Intronic
1136076226 16:27819318-27819340 ATGGGTTAGCAATGATTACCTGG + Intronic
1139773874 16:69301040-69301062 ATGGTTCAGCAGTTATTTGCAGG - Exonic
1150172903 17:63018736-63018758 ATGGATTAGCAGTTATTATCAGG - Intronic
1155101028 18:22609900-22609922 AGGGTTTAGCAGTTAATCTCAGG + Intergenic
1159520686 18:69517815-69517837 ATGGAATAGCATTTATTATATGG + Intronic
1160214498 18:76916330-76916352 ATGGATGTGCAGCTAGTATCTGG + Intronic
1162685931 19:12384262-12384284 GTGGATCTGCAGTTCTTATCAGG + Intronic
933024033 2:77231568-77231590 AAAGCTTAACAGTTATTATCTGG + Intronic
936530547 2:113273670-113273692 ATGAATTAGCATTTATTAATTGG - Intronic
941438955 2:165509404-165509426 CTGGATTCGAAGTTATTGTCAGG + Intronic
941528181 2:166631873-166631895 ATGGATCCGCAGATATTATCTGG + Intergenic
941939744 2:171021617-171021639 ATGGATTTACAGTTATGATTGGG + Intronic
943704936 2:191024456-191024478 CTGCATTAGCAGTTCTTGTCTGG - Intergenic
945190078 2:207178916-207178938 ATATGTTAGCTGTTATTATCAGG - Intergenic
946821906 2:223638757-223638779 ATGACTTAACACTTATTATCAGG + Intergenic
1169523832 20:6401651-6401673 ATGGGTTACCAGTGTTTATCTGG - Intergenic
1169562297 20:6814679-6814701 ATGTTTAAACAGTTATTATCAGG - Intergenic
1172532178 20:35639700-35639722 AAGCATTAGCAGTGATTATTTGG + Intronic
1173105791 20:40132823-40132845 ATGGGTTAGCTTTTATTTTCCGG - Intergenic
1176699490 21:10026230-10026252 TTGGATAAGCAGTTCTTAACCGG + Intergenic
1176729320 21:10475994-10476016 TTGGATTATCAGATGTTATCTGG + Intergenic
1177482776 21:21713310-21713332 AAGGACTAGCAGTTCTTTTCTGG + Intergenic
950355036 3:12400121-12400143 ATGAATTTGCAATCATTATCAGG - Intronic
950990991 3:17437507-17437529 TTGGATTATCAGATATGATCTGG - Intronic
951299788 3:20981729-20981751 ATGTAATAGCAATTATTACCTGG + Intergenic
953190209 3:40678899-40678921 ATTGATTGCCAGTTACTATCTGG - Intergenic
955046240 3:55362964-55362986 ATGGATGAGCAGATATTAAAAGG - Intergenic
956622335 3:71233952-71233974 CTGGAATTGCCGTTATTATCTGG + Intronic
956639044 3:71397351-71397373 GTGGATGAGCATTTATAATCTGG + Intronic
958547350 3:95571638-95571660 AGGAATTAGCACATATTATCGGG + Intergenic
960162961 3:114370471-114370493 AAGGATCAGCAGTCAGTATCAGG - Intronic
960800682 3:121536041-121536063 ATAAATTAGCAGTAAGTATCTGG + Intronic
960879554 3:122330952-122330974 ATGGATCAGCAATAATGATCCGG - Intronic
962629552 3:137262573-137262595 AAGGTTTTGCAGTTATGATCAGG + Intergenic
965576112 3:170220439-170220461 ATGGATATGCAGTTACTTTCAGG + Intergenic
966304741 3:178518676-178518698 ATGGATTATCAGTTTGTCTCTGG - Intronic
972862417 4:43186166-43186188 AAGAAATAGCAGTTATTCTCTGG + Intergenic
973805603 4:54523280-54523302 ACGGATTAGGAATTATTATAAGG - Intergenic
980371900 4:131884864-131884886 TTGGATAAGCAGTTCTTAACCGG + Intergenic
983063224 4:163181404-163181426 CTGTATTAGCAGTTATCTTCAGG - Intergenic
983833067 4:172355111-172355133 ATGGATTAGCTTTTATAATGAGG + Intronic
984060457 4:174983504-174983526 ATGGATTAGCAGCTATTAACTGG - Intergenic
984403611 4:179298895-179298917 ATTTATTAGCAGTAAGTATCTGG - Intergenic
985392861 4:189509578-189509600 ATGAATTATCTGTTTTTATCTGG + Intergenic
989805988 5:45605667-45605689 ATCAATTAACAGTTGTTATCTGG + Intronic
990771330 5:59249759-59249781 AAGAATTAGCAGTGATTATTTGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
993099522 5:83520140-83520162 ATGGATGATCCATTATTATCAGG - Exonic
993474507 5:88348003-88348025 ATGGATCAACTTTTATTATCTGG - Intergenic
993664411 5:90678078-90678100 ATGGATTTGCAGCAAATATCTGG - Intronic
997244515 5:132335814-132335836 ATGGATAAGAAGTAATAATCTGG - Exonic
1000269435 5:159669535-159669557 ATGGATTAGCAGTGTCTGTCTGG - Intergenic
1002004388 5:176220275-176220297 ATGGGTGAGCAGTAACTATCTGG - Intergenic
1002221982 5:177690351-177690373 ATGGGTGAGCAGTAACTATCTGG + Intergenic
1005256620 6:24010470-24010492 ATGGATGAGAAATAATTATCTGG - Intergenic
1012016561 6:93859791-93859813 ATGGATTAGCATCTAGTTTCTGG - Intergenic
1014649007 6:124012226-124012248 AAGCATTATCAGTCATTATCTGG - Intronic
1015907606 6:138133396-138133418 ATGGGTTATAAGTTATTATTTGG - Intergenic
1017330589 6:153193741-153193763 GTGGATTAGCAGCTATTGTTTGG - Intergenic
1017602472 6:156098682-156098704 ATGAATTATCAATTATTATCTGG + Intergenic
1018817806 6:167348552-167348574 ATGGATTATTAGTTACTTTCAGG - Intronic
1019199486 6:170302503-170302525 ATGTATTTGCAGTTTTTATTTGG - Intronic
1022110120 7:27225043-27225065 ATGAATTTACAGTTATTATTCGG - Intergenic
1027431294 7:78115144-78115166 AGGAATCAGCAGTTATTTTCTGG - Intronic
1028732434 7:94166836-94166858 AAGAATTTGAAGTTATTATCTGG - Intergenic
1032704035 7:134406696-134406718 ATTGATTTGCATTTATTGTCAGG + Intergenic
1034159804 7:148984774-148984796 ATTGCTTTGCAGATATTATCTGG + Intergenic
1034600268 7:152245604-152245626 TTGGATTATCAGATGTTATCTGG - Intronic
1037616611 8:20524969-20524991 ATGGATAAGCAGTTGTAACCTGG + Intergenic
1040583160 8:48714047-48714069 GTGGATGAGCAGTTATAATTTGG - Intronic
1040819879 8:51544318-51544340 ATGGATGATAATTTATTATCAGG - Intronic
1042380207 8:68104558-68104580 ATGGATTACCAGTTGTAACCAGG - Intronic
1045913500 8:107438385-107438407 ATGGATGAACAGTCTTTATCAGG - Intronic
1051687281 9:19670881-19670903 CTGGATTAACAGTTGTTATCAGG - Intronic
1052548350 9:29910692-29910714 ATGGATGAACAGTTATTACCAGG + Intergenic
1053439057 9:38099723-38099745 ATGGATTAGCTGTGATAATAGGG - Intergenic
1053636605 9:40012417-40012439 TTGGATAAGCAGTTCTTAACCGG + Intergenic
1053769386 9:41452199-41452221 TTGGATAAGCAGTTCTTAACCGG - Intergenic
1054317467 9:63609491-63609513 TTGGATAAGCAGTTCTTAACCGG + Intergenic
1054548055 9:66363702-66363724 TTGGATAAGCAGTTCTTAACCGG - Intergenic
1055423517 9:76169027-76169049 ATGTATTAGTAGTTATTACTGGG + Intronic
1057485494 9:95479745-95479767 ATGGATTTGTAGTTTTCATCAGG - Intronic
1060123720 9:121021341-121021363 ATGGATTAGCAGATTGTCTCTGG + Intronic
1203584938 Un_KI270746v1:58085-58107 TTGGATTATCAGATGTTATCTGG - Intergenic
1202345279 Y:23916272-23916294 TTGGAATAGCTATTATTATCAGG + Intergenic
1202525491 Y:25753817-25753839 TTGGAATAGCTATTATTATCAGG - Intergenic