ID: 1150174067

View in Genome Browser
Species Human (GRCh38)
Location 17:63031824-63031846
Sequence ACCTTCTACATGGAGTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150174065_1150174067 17 Left 1150174065 17:63031784-63031806 CCAGTATTACTAAAATATAGTAT 0: 1
1: 0
2: 2
3: 36
4: 364
Right 1150174067 17:63031824-63031846 ACCTTCTACATGGAGTACTAAGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150174067 Original CRISPR ACCTTCTACATGGAGTACTA AGG Intronic
906516639 1:46442987-46443009 GCCTTCTACAAGGGGTGCTACGG + Intergenic
911562985 1:99429228-99429250 GGCTTCTACATGGAATAATAGGG + Intergenic
912252731 1:108027866-108027888 ACCTTCTCCATGGAGAAAGATGG - Intergenic
919015765 1:192033074-192033096 CCCTTCTACCTGGAATACTCTGG + Intergenic
920054529 1:203182639-203182661 TCAGTCTACATGGAGTGCTAGGG + Intronic
921826855 1:219681751-219681773 GTCTTCTACATGGAGCAATATGG - Intergenic
1064320379 10:14299135-14299157 ACCTTCTATCTGGACTACTGGGG - Intronic
1069817456 10:71207447-71207469 ACCTTAAACATGGAGAACTCAGG - Intergenic
1083354538 11:62056396-62056418 ACCTTATACATGGATTAGCAAGG - Intergenic
1087150894 11:94858643-94858665 TCATTCTCCCTGGAGTACTAAGG + Intronic
1092693695 12:11144695-11144717 ACCCTCCTGATGGAGTACTATGG + Intronic
1096095755 12:48934555-48934577 GCATTCTAAATTGAGTACTAAGG + Intronic
1097509480 12:60519325-60519347 ACATTCTATATGGAGTACAAAGG + Intergenic
1097810173 12:64010467-64010489 GCTTTCTACATGGAGTGCTATGG - Intronic
1099928075 12:89041804-89041826 ACCTTCTTCATAGAAAACTAAGG - Intergenic
1100912214 12:99377953-99377975 ACCTTATAGATGGAATACTCAGG + Intronic
1103642570 12:122363775-122363797 ACATACTACATGTATTACTAAGG + Intronic
1105241741 13:18614796-18614818 TCCTTCTCCATGTAGAACTAGGG + Intergenic
1108140529 13:47416290-47416312 ACCTTCAACATGCAGGACTGAGG + Intergenic
1108703870 13:52967587-52967609 CCCTCCTCCATGGAGTAATAGGG + Intergenic
1109056825 13:57560921-57560943 AGCTTCAAGATGTAGTACTATGG - Intergenic
1110672557 13:78198614-78198636 ACCATATCCATGCAGTACTATGG + Intergenic
1111235657 13:85404765-85404787 TCCTTCTATATGGAGTACTCAGG + Intergenic
1111589588 13:90326502-90326524 ACCTTCTACAGAGACTAATAAGG + Intergenic
1111836317 13:93392769-93392791 ATTTTTTACATGAAGTACTATGG + Intronic
1113361280 13:109633825-109633847 ACCTTCAACCTGGGGTTCTATGG + Intergenic
1113564349 13:111310069-111310091 ACCATCAACATGGAGAACTGAGG - Intergenic
1113702931 13:112400482-112400504 ACTGTCTACATGGGCTACTAGGG + Intronic
1120526041 14:85578269-85578291 AATGTCTACATGGAGAACTAGGG - Intronic
1120753887 14:88223751-88223773 TCCTTCTGCATTGAGTACTCTGG + Intronic
1121068028 14:90987914-90987936 ACCTTGTAAATGGAATAGTATGG - Intronic
1123489575 15:20770213-20770235 TCCTTCTCCATGTAGAACTAGGG - Intergenic
1123546074 15:21339300-21339322 TCCTTCTCCATGTAGAACTAGGG - Intergenic
1127573774 15:60270628-60270650 ACCTTCTAAGTGGAGCACTTAGG + Intergenic
1202954417 15_KI270727v1_random:66572-66594 TCCTTCTCCATGTAGAACTAGGG - Intergenic
1135203039 16:20455826-20455848 ATCTTTTAAATGGAGTACTTAGG - Intronic
1135216060 16:20572035-20572057 ATCTTTTAAATGGAGTACTTAGG + Intronic
1136588443 16:31202497-31202519 AGCTTCTACCTGGAGACCTACGG - Exonic
1136643758 16:31590941-31590963 GCCTGCTACATGGAATACTTGGG + Intergenic
1136661845 16:31769825-31769847 GCCTGCTACATGGAATACTTGGG - Intronic
1137306574 16:47206718-47206740 CACTTCTTCATGGACTACTATGG - Intronic
1141358716 16:83374254-83374276 ACCTTTTACCTGGAGTAAAATGG - Intronic
1145406394 17:22600296-22600318 ACCTTTTACATGTAGTTCTATGG + Intergenic
1150174067 17:63031824-63031846 ACCTTCTACATGGAGTACTAAGG + Intronic
1150868974 17:68883577-68883599 ACCTGAAACATGGAGTATTAAGG - Intronic
1154447220 18:14445110-14445132 TCCTTCTCCATGTAGAACTAGGG - Intergenic
1157346035 18:46834293-46834315 ACCTTCTGAATGGAGAACAAAGG + Intronic
1164816624 19:31209135-31209157 GCTTTCTACATGGAGTCATAAGG - Intergenic
926977390 2:18528956-18528978 GCCTTCTGCATGCAGTTCTAGGG + Intergenic
928743502 2:34384189-34384211 ACCTTTTACATGGAATAATTTGG - Intergenic
928873578 2:36011046-36011068 AGCTTCTACAGGGAGTTCAATGG - Intergenic
931087879 2:58853944-58853966 ATCTTCTTCATGGGGTACTAAGG - Intergenic
938838193 2:135129753-135129775 TCCTTCTAGATGGAATTCTAAGG + Intronic
942504658 2:176628898-176628920 ACATTCTACTTGGGTTACTAAGG - Intergenic
944457707 2:199911962-199911984 ACCTTCCCCATGGGGTTCTATGG - Intronic
1171058184 20:21928379-21928401 ACATTCTGCATGGAGCACTCAGG + Intergenic
1176453883 21:6890841-6890863 TATTTCTACATGGAATACTATGG - Intergenic
1176832058 21:13755889-13755911 TATTTCTACATGGAATACTATGG - Intergenic
1178397214 21:32253131-32253153 ACCATCTGCATGGTGTTCTATGG - Intergenic
1178799844 21:35783149-35783171 ACCTTCTAGAGGGAGTATTCAGG - Intronic
951563261 3:23988756-23988778 ATCTTCTACATCGAATAGTAAGG + Intergenic
953074132 3:39551930-39551952 ACCTTATACATGGAGAGCTCTGG + Intergenic
953288253 3:41634344-41634366 ACCTTCCAGATGAAGAACTAGGG - Intronic
954008229 3:47610459-47610481 ACCTTCTACAGTGAGAACAAAGG + Intronic
956149748 3:66228391-66228413 ACTTTCAACATGTAGTAGTAGGG - Intronic
956463193 3:69492712-69492734 ACCGCCTAAATGGAGCACTAAGG - Intronic
956721720 3:72123938-72123960 CCCTTCTAGATGGAGTTCTGGGG - Intergenic
963462714 3:145637416-145637438 ACCTGCTGCATGGAGCACTCTGG - Intergenic
966440605 3:179940454-179940476 ACTTTCTGCATGAAGTGCTACGG + Intronic
970929060 4:21487515-21487537 TCCTTCCACAGGGAGCACTATGG - Intronic
988206928 5:28149702-28149724 ATCTTCTACTTGGAGAACTATGG - Intergenic
995243486 5:109911791-109911813 AACTTCTCCAAGGAGTCCTAGGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
1000911010 5:167021856-167021878 ATTTTCTAGATGGAGTACTGAGG - Intergenic
1003847720 6:10190546-10190568 ACCTTCTGAGTGGAGGACTAGGG - Intronic
1003931039 6:10924928-10924950 ACCTTCTTCCTGGAGTCCTGAGG + Intronic
1008622983 6:53289850-53289872 ACCATCAACTTGGAGCACTAGGG + Intronic
1021807303 7:24370035-24370057 ACCTTCTACAAAAAGTACAAAGG - Intergenic
1024280261 7:47712697-47712719 ACCTTCCAAATGGAGGACTAAGG + Intronic
1024838630 7:53556400-53556422 AAGTTCTACATGGAGGAATAAGG + Intergenic
1026791796 7:73337638-73337660 ACCTTCCAAATGGAGTTCCAGGG + Intronic
1033469812 7:141635414-141635436 ACCTTCTACTTGGCTAACTAGGG + Intronic
1040759609 8:50823241-50823263 AGCTTCTAAGTGGAGTACTGCGG + Intergenic
1048746466 8:137619778-137619800 ACCTTCCACCTGAAGAACTAGGG - Intergenic
1056299942 9:85230405-85230427 ACCTTCTATCTGAAGAACTAGGG - Intergenic
1057635627 9:96763460-96763482 ACCTTCTATATGGAGTTACAAGG + Intronic
1057804803 9:98212408-98212430 ACCTTCTGAATTGAGTCCTAAGG - Intronic
1058789864 9:108433330-108433352 ACCTTCTACATGGATGGCAAGGG - Intergenic
1187185530 X:16981198-16981220 ATCTGCTCCATGGAGTACTGTGG - Intronic
1188653180 X:32656877-32656899 ACCTTGAAAATGGAGTAATATGG + Intronic
1189496690 X:41515034-41515056 ATATTCTACAAGGAATACTATGG + Intronic
1192820417 X:74638828-74638850 ATCTTTTAAATGGAGTACTTAGG - Intergenic
1197515898 X:127428541-127428563 AACTTCTTCATGGTGGACTATGG - Intergenic