ID: 1150176257 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:63059922-63059944 |
| Sequence | CTAGACATGTCCACTGCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 187 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 24, 4: 161} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150176252_1150176257 | 26 | Left | 1150176252 | 17:63059873-63059895 | CCGGGTTTCTTTTAATGGAGAAT | 0: 2 1: 16 2: 145 3: 337 4: 751 |
||
| Right | 1150176257 | 17:63059922-63059944 | CTAGACATGTCCACTGCTACTGG | 0: 1 1: 0 2: 1 3: 24 4: 161 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150176257 | Original CRISPR | CTAGACATGTCCACTGCTAC TGG | Intronic | ||