ID: 1150176257

View in Genome Browser
Species Human (GRCh38)
Location 17:63059922-63059944
Sequence CTAGACATGTCCACTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150176252_1150176257 26 Left 1150176252 17:63059873-63059895 CCGGGTTTCTTTTAATGGAGAAT 0: 2
1: 16
2: 145
3: 337
4: 751
Right 1150176257 17:63059922-63059944 CTAGACATGTCCACTGCTACTGG 0: 1
1: 0
2: 1
3: 24
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150176257 Original CRISPR CTAGACATGTCCACTGCTAC TGG Intronic