ID: 1150179074

View in Genome Browser
Species Human (GRCh38)
Location 17:63095652-63095674
Sequence CTGAGTCAGCTGATCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150179074_1150179076 -9 Left 1150179074 17:63095652-63095674 CCAACCTAGATCAGCTGACTCAG 0: 1
1: 1
2: 1
3: 39
4: 237
Right 1150179076 17:63095666-63095688 CTGACTCAGAGTCAGTCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 177
1150179074_1150179077 7 Left 1150179074 17:63095652-63095674 CCAACCTAGATCAGCTGACTCAG 0: 1
1: 1
2: 1
3: 39
4: 237
Right 1150179077 17:63095682-63095704 CTGAAGGCTCATGAGCATACAGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150179074 Original CRISPR CTGAGTCAGCTGATCTAGGT TGG (reversed) Intronic
900684652 1:3940330-3940352 CTCAGTCAGCTGCTCTAGGCAGG - Intergenic
901104301 1:6743419-6743441 CTGATTAAGCTGATCTAGGGTGG - Intergenic
901171800 1:7264195-7264217 CTGATTCAGTTGGTCTGGGTGGG + Intronic
902987369 1:20163219-20163241 CTGAGACAACTGATCCAGGTGGG + Intronic
905537142 1:38731150-38731172 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
907098969 1:51809951-51809973 CTGAGTCAGAGGGTCTGGGTAGG - Intronic
907183860 1:52594128-52594150 CTGATTCAGTTGGTCTAGGGTGG + Intergenic
908283868 1:62572155-62572177 TTGTGACAGCCGATCTAGGTTGG - Intronic
908398141 1:63745149-63745171 CAGAGTTGGCTGATCTAGGATGG - Intergenic
908983206 1:69983897-69983919 CTGATTCAGCAGATCTGGGGTGG + Intronic
910222948 1:84907342-84907364 CTGATTCAGCAAGTCTAGGTTGG - Intergenic
910763089 1:90754353-90754375 CTGATTCAGTAGATCTGGGTGGG + Intergenic
910859810 1:91732386-91732408 CTGATTCAGTTGGTCTGGGTTGG + Intronic
913049345 1:115103039-115103061 CTGGGTCAGCTGGTCCAGGATGG - Intergenic
913377153 1:118165216-118165238 CTGATTCAGTAAATCTAGGTTGG + Intronic
916365003 1:164016628-164016650 CTCAGCCAGATGATCAAGGTTGG + Intergenic
916882718 1:169035660-169035682 CTGATTTATCTGATCTATGTTGG + Intergenic
918268855 1:182875319-182875341 CTGACTCAGTAGATCTAGGGTGG - Intronic
919871448 1:201824844-201824866 CTGATTCAGCAGATCTGGGATGG - Exonic
920461306 1:206142627-206142649 CTGACTCAGTAGATCTGGGTAGG + Intergenic
920530289 1:206696992-206697014 TTGAGTCAGCAGATCCAAGTGGG - Intronic
920971151 1:210744707-210744729 CTAATTCAGTTGATCTAGGGTGG + Intronic
924439737 1:244076349-244076371 CAGAGTCAGCTGATCTAGGTTGG - Intergenic
1063220557 10:3963430-3963452 GTGGGCCAGCTGATCCAGGTGGG - Intergenic
1063274536 10:4550785-4550807 CTGAGTCAGTAGGTCTGGGTTGG - Intergenic
1063472487 10:6299356-6299378 GTGAGTCAGCTGACCCAGGAGGG + Intergenic
1065117848 10:22499405-22499427 CTGAGGCAGCGGAACCAGGTGGG - Intergenic
1065334024 10:24636372-24636394 CTGATTCAGGAGATCTAGGGTGG - Intronic
1066278534 10:33891833-33891855 CTGATTCAGTAGATCTGGGTGGG + Intergenic
1068415592 10:56717350-56717372 CTGATTCAGTTGGTCTAGGATGG - Intergenic
1072745314 10:97935498-97935520 CTGACTCAGCAGGTCTGGGTGGG - Intronic
1072801652 10:98396407-98396429 CTGGCTCAGCTGATCTGGTTTGG - Intronic
1074104257 10:110376767-110376789 CTGGGTCAGCTGGCCTTGGTGGG - Intergenic
1075188843 10:120287554-120287576 CTGACTCAGTGGATCAAGGTGGG + Intergenic
1076077234 10:127544058-127544080 CTGGGGTGGCTGATCTAGGTTGG + Intergenic
1079480942 11:20879164-20879186 CTTAGCCAGGTGATCTAGGAAGG + Intronic
1079483487 11:20909370-20909392 CTGATTCAGTGGACCTAGGTTGG + Intronic
1079547325 11:21648156-21648178 CTGATTCAGTTGTTCTAGGTAGG - Intergenic
1081681511 11:45008903-45008925 CTGATTCAGAGGATCTAGGGTGG + Intergenic
1082221467 11:49643515-49643537 CTGAGTCAGTAGATCTGGGTTGG + Intergenic
1082294296 11:50419355-50419377 CTGATTCAGTAGATCTAGGGTGG - Intergenic
1084361171 11:68669567-68669589 CTGGGTCAGCTGACCCTGGTGGG - Intergenic
1084644706 11:70449002-70449024 TTTAGTCATCTGATCTGGGTGGG + Intergenic
1084738215 11:71119741-71119763 CTGATTCAGCAGGTCTGGGTGGG + Intronic
1086627573 11:88975637-88975659 CTGAGTCAGTAGATCTGGGTTGG - Intronic
1087073648 11:94107028-94107050 CTGATTCAGCAGGTCTGGGTCGG - Intronic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1092291408 12:7161556-7161578 CAGAGGCAGCTGATCCAGGAAGG - Intergenic
1092670228 12:10853841-10853863 CTGAGTCTGCTGATGCAGCTGGG + Intronic
1092722520 12:11455898-11455920 CTGAGTTACCTGATTTACGTTGG + Intronic
1093222873 12:16445138-16445160 CTTAGTGAGCTGATCTCGGATGG - Intronic
1094134391 12:27108658-27108680 CTGATTCAGCAGACCTAGGGTGG + Intergenic
1094273344 12:28641547-28641569 CTGAGTCAGAGGATTTAGCTTGG - Intergenic
1094635075 12:32218389-32218411 CTGATTCAGTAGATCGAGGTAGG + Intronic
1095858514 12:46888780-46888802 CTTATTCAGCTGGTCTGGGTAGG + Intergenic
1099317920 12:81107743-81107765 AGGCATCAGCTGATCTAGGTTGG + Intronic
1099498906 12:83387249-83387271 CTCTGCCACCTGATCTAGGTTGG + Intergenic
1102202277 12:111065819-111065841 CTGACTCAGGAGATCTGGGTTGG - Intronic
1102606234 12:114069641-114069663 CTGAGTCCACTGATGTAGTTGGG - Intergenic
1103005565 12:117417593-117417615 CTGATTCAGAAGATCTGGGTGGG - Intronic
1106901436 13:34358108-34358130 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
1108055952 13:46485319-46485341 CTGAATCAGCTCAGCTAGCTAGG + Intergenic
1109065180 13:57678368-57678390 CTGAGGCAGTTGATCCAGTTAGG + Intronic
1110572335 13:77019608-77019630 CTGATTCAGATGGTCTGGGTTGG - Intronic
1110744735 13:79039141-79039163 TTGAGTCACCTCATCTTGGTTGG + Intergenic
1112064357 13:95776834-95776856 TTGCTTCAGCTGATGTAGGTGGG + Intronic
1112827137 13:103404659-103404681 CTGATTCAGCAGATCTGGGGTGG + Intergenic
1112990403 13:105506551-105506573 CTGATTCAGCAGGTCTGGGTGGG + Intergenic
1113636805 13:111925064-111925086 CTGATTCAGGAGGTCTAGGTGGG + Intergenic
1113829961 13:113287936-113287958 CTGAGTCTGCTGATGGAGGCTGG - Intergenic
1115859512 14:37668367-37668389 TGGAGTCAGCTAATCTAGGCTGG + Intronic
1116418019 14:44701595-44701617 CAGGGTTAGCTGATCTTGGTTGG + Intergenic
1117375904 14:55118030-55118052 CTGAGGCAACTCTTCTAGGTTGG + Intergenic
1119436495 14:74600899-74600921 CTGATTCAGCAGATCTGGGGTGG - Intronic
1119542184 14:75447145-75447167 CTGATTCAGCTGGTCTGAGTGGG + Intronic
1119610529 14:76057989-76058011 CTGAATCAGCTGGTCTGGGTGGG - Intronic
1121702291 14:95963677-95963699 CTGAGTCAGGAGCTCTAGGGGGG - Intergenic
1121837779 14:97107284-97107306 CTGATTCAGCAGCTCTGGGTGGG + Intergenic
1126232871 15:46347574-46347596 CTCAGTCAGATAATCAAGGTTGG - Intergenic
1126466495 15:48965528-48965550 GGGAGCCAGCTCATCTAGGTAGG + Intergenic
1126750034 15:51867176-51867198 ATCAGGCAGCTGATCCAGGTGGG + Intronic
1127267717 15:57375095-57375117 CAGAGTTAGCAGGTCTAGGTTGG - Intergenic
1127725318 15:61743943-61743965 CTGACTCAGTTGGTCTGGGTGGG + Intergenic
1128722190 15:69958203-69958225 GTGATTCAGCAGATCTAGGGTGG - Intergenic
1129714870 15:77841158-77841180 CTGATTCAGCTGATTTGGGATGG - Intergenic
1129822686 15:78615595-78615617 CTGAGTCAGTGGGTCTGGGTAGG - Intronic
1130556360 15:84925325-84925347 CTGATTCAGCAGGTCTAGGGTGG - Intronic
1131741770 15:95400586-95400608 AAGAGTCAGCTGATGTAGGTGGG + Intergenic
1131761351 15:95626347-95626369 CTGATTCAGCAGATCTGGGGTGG - Intergenic
1132017535 15:98331986-98332008 CTGAGGCAGCTGTTCCTGGTTGG - Intergenic
1132781170 16:1626500-1626522 CTGAGTGGGCTGATTTAGGCGGG + Intronic
1133152101 16:3841852-3841874 CTGATTCAGCAGATTTTGGTTGG - Intronic
1136281420 16:29213668-29213690 CTGACTCAGCAGGTCTGGGTGGG - Intergenic
1136615528 16:31396041-31396063 CTGGAGCAGCTGACCTAGGTGGG - Intronic
1137604647 16:49779468-49779490 CTGACTCAGCAGGTCTGGGTAGG - Intronic
1139503018 16:67383478-67383500 CTGAGTCAGCAGGTCTGGGTTGG + Intronic
1140209535 16:72959685-72959707 CTGAGCCAGCTGACCCAGGGCGG - Exonic
1140294006 16:73690251-73690273 CTGAGTCTGCAAATCTAGTTTGG - Intergenic
1140525254 16:75617694-75617716 CTGATTCAGCATATCTAGGGTGG - Intronic
1140841172 16:78840662-78840684 CTGATTCAGTAGGTCTAGGTGGG + Intronic
1141090073 16:81124081-81124103 CTGACTCAGCAGGTCTAGGGCGG - Intergenic
1141246892 16:82316326-82316348 CTGATTCAGCTGGTCTGGGCAGG + Intergenic
1141716689 16:85730888-85730910 TTCAGTCAGCTGATCTGGGGGGG - Intronic
1141879737 16:86849929-86849951 CTGATTCAGCAGGTCTAGGGTGG - Intergenic
1142085790 16:88179596-88179618 CTGACTCAGCAGGTCTGGGTGGG - Intergenic
1145275584 17:21427441-21427463 CTAAGTCAGCTGACCTATGTTGG + Intergenic
1145313433 17:21713350-21713372 CTAAGTCAGCTGACCTATGTTGG + Intergenic
1145711883 17:26985327-26985349 CTAAGTCAGCTGACCTATGTTGG + Intergenic
1146998288 17:37340464-37340486 CTGATTCAGCAGATCTAGGGTGG - Intronic
1147521663 17:41179042-41179064 CTGAGTCATCTAATTTGGGTTGG - Intergenic
1148455710 17:47810355-47810377 CTGAGTCAGATGACCTCGATGGG + Intronic
1148794273 17:50189642-50189664 CAGAGTCCACTGCTCTAGGTTGG - Intronic
1148908270 17:50925519-50925541 CTGATTCAGCAGATCTAAGGTGG + Intergenic
1149141458 17:53437299-53437321 ATGTGTCAGCTGGTCCAGGTTGG + Intergenic
1149515653 17:57279024-57279046 CTGATACAGGTGTTCTAGGTGGG + Intronic
1150179074 17:63095652-63095674 CTGAGTCAGCTGATCTAGGTTGG - Intronic
1150586510 17:66523100-66523122 CTGAGTCACCTGGTAGAGGTGGG + Intronic
1150958781 17:69891812-69891834 CTGATTCAGCTGGCCTGGGTGGG - Intergenic
1151401030 17:73856322-73856344 CTGATTCAGCGGAACTAGGCAGG + Intergenic
1151426016 17:74031592-74031614 CTGATTCAGCAGATCTGGGCTGG + Intergenic
1156407673 18:36798336-36798358 CTGATTCAGGAGATCTAGGGTGG - Intronic
1157527055 18:48391732-48391754 CTGATTCAGGTGGTCTGGGTAGG + Intronic
1159236363 18:65679280-65679302 CTGATTCAGTTGGTCTAGGATGG - Intergenic
1160451259 18:78967449-78967471 CTAAGTCACATGATCTAGGCAGG + Intergenic
1163020358 19:14478169-14478191 CTGACCCAGCTGAGGTAGGTGGG + Exonic
1163603521 19:18262205-18262227 CTCAGTGAGCTGATATGGGTGGG + Intronic
1167854293 19:52225740-52225762 CTGGGTCAGCTTCTCTAGGATGG - Exonic
1168462194 19:56568240-56568262 CTGAGTCAGGTTATCTGGTTAGG - Intronic
925966505 2:9071749-9071771 CTGATTCAGTTGATCAAGGGAGG + Intergenic
926996141 2:18737901-18737923 CTGATTCAGCAGATCTGGGGTGG + Intergenic
927285978 2:21357082-21357104 CTGAATCAGCAGGTCTAGGGTGG - Intergenic
927411150 2:22827949-22827971 CTTACTCAGCTGACTTAGGTGGG - Intergenic
932272353 2:70421612-70421634 CTGATTCAGCAGGTCTAGGGTGG + Intergenic
933458296 2:82544916-82544938 CAGACTCAGGTGATCTAGTTAGG - Intergenic
934932820 2:98442153-98442175 CTGATTCAGCAGATCTGGGATGG + Intergenic
934995958 2:98960684-98960706 CAGAGGCAGCTGATGTAGGGAGG - Intergenic
935648866 2:105365086-105365108 TTGAGTTAGCTGATGTGGGTGGG - Intronic
936006564 2:108894086-108894108 GTCAGTCAGCTGACTTAGGTTGG - Intergenic
936635680 2:114254392-114254414 GTGAGTCAGCTGATTTAGGCTGG + Intergenic
937377764 2:121349346-121349368 CTGAGTGAGCAGGTCTGGGTGGG - Intronic
937437241 2:121890511-121890533 CTGAGTCTGCAGGTCTAGGGTGG + Intergenic
938580164 2:132638456-132638478 CTGATTCAGGAGATCTGGGTTGG + Intronic
938964857 2:136379409-136379431 CTGACTCAGCAGGTCTAGCTGGG - Intergenic
939230795 2:139423859-139423881 CTGAATCAGTTGTTCTAGGGTGG - Intergenic
939533839 2:143399724-143399746 CGGAGTCAGATGGTCTGGGTTGG - Intronic
939681648 2:145142353-145142375 CTGAATCAGGTGGTCTAGGATGG + Intergenic
940394179 2:153168331-153168353 CTGAATCAGCAGACCTGGGTTGG + Intergenic
944912762 2:204326600-204326622 CTGATTCAGTAGATCTGGGTGGG + Intergenic
945442329 2:209894591-209894613 CTGATTCAGCAGATCTGGGGTGG + Intronic
1168768570 20:398865-398887 CTGGGTCAGATGATCTAGGGTGG - Intergenic
1169447172 20:5682201-5682223 GGGTGTCAGCTGATCTAGGCAGG + Intergenic
1169490777 20:6069763-6069785 GTGGGTCAGCTGATCTAGCTCGG + Intergenic
1169698119 20:8414903-8414925 CTGAGTCAGTAGGTCTGGGTGGG - Intronic
1169787541 20:9376244-9376266 CTGACTCAGCAGGTCTGGGTGGG - Intronic
1169975103 20:11316433-11316455 CTGATTCAGCAGGTCTAGGGTGG + Intergenic
1169995903 20:11556329-11556351 CTGATTCAGTAGATCTAGGATGG - Intergenic
1170138473 20:13101766-13101788 CTGAGTGAGCAGGTCTGGGTGGG + Intronic
1171151392 20:22829140-22829162 GAGAGTCAGCTAATCTAGGCTGG - Intergenic
1172398644 20:34629572-34629594 AGGAGTCAGCTGATCTAGGTTGG - Intronic
1172885876 20:38230505-38230527 CTGATTCAGTTGATGAAGGTGGG - Intronic
1173066643 20:39719480-39719502 CTGAGTCAGGAAATCTAGGGTGG - Intergenic
1173174377 20:40753290-40753312 GAGGTTCAGCTGATCTAGGTAGG - Intergenic
1174262465 20:49306643-49306665 CTGATTCAGCGGGTCTGGGTGGG + Intergenic
1175303326 20:57958577-57958599 CTGACTCAGTAGATCCAGGTTGG - Intergenic
1175318054 20:58065638-58065660 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
1175531851 20:59678941-59678963 CTGAGTTAGCAGGTCTGGGTGGG + Intronic
1177888897 21:26781098-26781120 CTGGGTCTGCTGATCTTGGCTGG + Intergenic
1179140852 21:38723606-38723628 GGGGGTCAGCTAATCTAGGTTGG - Intergenic
1181436694 22:22915233-22915255 CTGACACAGCTGCTCTGGGTTGG - Intergenic
1181825371 22:25511073-25511095 CTGAGTCAGTGGATTTGGGTGGG + Intergenic
1182530061 22:30948424-30948446 CTGATTCAGTGGATCTGGGTAGG - Intronic
1182695955 22:32199524-32199546 CTGACACAGCTGCTCTGGGTTGG - Intronic
1183238596 22:36639077-36639099 CTGAGGCAGGTGTTCCAGGTTGG + Intronic
949905441 3:8854819-8854841 CTGAGTCAACTTAGCTAAGTGGG - Intronic
951620010 3:24591388-24591410 CTGATTCAGCAGATCTGGGTTGG - Intergenic
952759380 3:36900527-36900549 CTGATTCAGGTGATCAACGTGGG - Intronic
953393343 3:42547008-42547030 CTGACTCAGCAGAGCCAGGTGGG + Intergenic
953667857 3:44938914-44938936 CTGAGTCCGCTGAGCTACCTTGG + Intronic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
953831167 3:46298623-46298645 CTGATTCAGCAGGTCTGGGTTGG - Intergenic
953959251 3:47254869-47254891 CTGATTCTGCTGGTCTAGGGTGG - Intronic
956193188 3:66626460-66626482 CTGATTCAGCTTATCTGGGCTGG + Intergenic
957337992 3:78857627-78857649 CTGAGTCAGCAGGTCTGGGGTGG - Intronic
957956332 3:87193222-87193244 ATGATTCTGCTGATCTAGGCTGG + Intergenic
958812744 3:98880547-98880569 CTGATTCAACTGGTCTAGGATGG + Intronic
960669890 3:120145740-120145762 CTGATTCAGCAGATCTGGGTGGG + Intergenic
961243721 3:125433957-125433979 CTGAGTCAGCAGGTCTGGTTGGG + Intergenic
961502244 3:127344758-127344780 CTGAGTCAGTTACTATAGGTGGG + Intergenic
963989056 3:151632202-151632224 ATGATTCAGTTGATCTAGGTGGG + Intergenic
964726595 3:159820006-159820028 CAGAGCCAGTTGATCTTGGTTGG + Intronic
964731190 3:159866969-159866991 CTGATTCAGTAGATCTAGGTGGG + Intronic
964914483 3:161823533-161823555 TTGATTCAGCTGATCTAGATGGG + Intergenic
968019011 3:195367211-195367233 CTAATTCAGCAGATCTAGGGTGG + Intronic
970314709 4:14818071-14818093 CTGATTCAGTTGTTCTAGGTTGG - Intergenic
971091281 4:23348605-23348627 CTGATTCAGCAGATCTTGGATGG + Intergenic
971287939 4:25308243-25308265 CAGAGTGAGCTGATCTTGATTGG + Intergenic
971448634 4:26779102-26779124 CTGATTCAGTAGATCTAGTTTGG + Intergenic
976656087 4:87490075-87490097 CTGATTTAACTGAACTAGGTTGG - Intronic
977939815 4:102846148-102846170 CTGAGTTAGCTGATCTTAGTGGG - Intronic
978608202 4:110505632-110505654 CTGAGTCAGCTGTTCTAATTAGG + Intronic
978958710 4:114648171-114648193 CTGAGTAAGCTGAAATATGTTGG - Intronic
981262320 4:142736147-142736169 CTGACTCAGCTGGTCTGGGGTGG - Intronic
983641185 4:169945276-169945298 CTGATTCAGTTGGTCTGGGTTGG + Intergenic
984549973 4:181148135-181148157 CTGATTCAGAGGATCTGGGTGGG - Intergenic
984834030 4:184002514-184002536 AGGAGTCAGCTGAGCCAGGTGGG + Intronic
984834511 4:184007350-184007372 CTGACCCAGGTGTTCTAGGTTGG + Intronic
986408914 5:7457021-7457043 CTGAGTCAGTTGTTCTGGGGTGG - Intronic
986722844 5:10572348-10572370 CTGACTCAGCAGGTCTTGGTGGG - Intronic
986930589 5:12815572-12815594 CTGATTCAGTTGATCTAAGATGG - Intergenic
996167133 5:120238108-120238130 CTGATTCAGTAGATCTAGGTAGG - Intergenic
998399939 5:141843387-141843409 ATGACTCAGCTGCTCTTGGTGGG + Intergenic
998893281 5:146769309-146769331 CTGATTCAGCAGGTCTAGGGTGG - Intronic
999428822 5:151508908-151508930 CTGATTCAGTTGGTCTAGGCTGG + Intronic
1003570706 6:7254657-7254679 CTGACTCAGCAGGTCTGGGTGGG - Intergenic
1004374143 6:15077052-15077074 CTGAGTCAGAACATCTAGGATGG - Intergenic
1005226314 6:23647144-23647166 CTGTGTCAACTGAACTAGGTTGG + Intergenic
1006138411 6:31911583-31911605 CTGAGTCAGTAGGTCTGGGTGGG + Intronic
1008044757 6:46840364-46840386 CTGGGTCAGTAGATCTAGGGTGG + Intergenic
1008891374 6:56496328-56496350 CTGTGTCACATGATCTAGGTAGG + Intronic
1009554124 6:65139873-65139895 CTGAGTCAGTAGCTCCAGGTAGG - Intronic
1011212914 6:84973199-84973221 CTGGCTCAGCTGATCTTGGCAGG - Intergenic
1018080178 6:160252723-160252745 CTGATCCAGCAGATCTGGGTGGG - Intronic
1018388270 6:163323729-163323751 CTGATTCAGCGGCTCTAGGGAGG - Intergenic
1018421317 6:163643051-163643073 CTGACTCAGCTGATCAAAGTAGG + Intergenic
1021387382 7:20048063-20048085 CTGATTCAGTTGGTCTAGGAAGG + Intergenic
1022834128 7:34097597-34097619 CTGATTCAGTGGGTCTAGGTGGG + Intronic
1023120040 7:36900078-36900100 CTGATTCAGTAGATCTAGGGTGG - Intronic
1024299744 7:47877799-47877821 CTGAGTCAGCAGGTCTAGGGTGG - Intronic
1026799698 7:73392032-73392054 TTGATTCAGCAGATCTGGGTTGG + Intergenic
1028938061 7:96487828-96487850 CTGATTCAGAAGATCTAGGGTGG + Intronic
1029415660 7:100441708-100441730 CTGAGCCAGGTGCTATAGGTGGG + Intergenic
1030079435 7:105764431-105764453 CTGATTCAGTAGATCTGGGTTGG - Intronic
1030226130 7:107153113-107153135 CTGGGTAAGCTTATCTAGTTCGG - Intronic
1031505631 7:122578551-122578573 CTGACTCAGCAGATCTAGAGTGG + Intronic
1031666186 7:124485342-124485364 GGGAGTCAGCTGATCTAGGCTGG + Intergenic
1034746562 7:153528644-153528666 CTCAGTCAGGTGATATAGTTCGG - Intergenic
1034865804 7:154640704-154640726 CTAAGTCTGAGGATCTAGGTGGG + Intronic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1039273887 8:35913788-35913810 CTGAGTCAGTAGGTCTGGGTTGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040416688 8:47202025-47202047 CTGATTCAGTAGGTCTAGGTTGG + Intergenic
1041397333 8:57405030-57405052 CTGATTCAGTTGATCTTGGGAGG - Intergenic
1042806584 8:72776840-72776862 CTGAATCAGCTGAGCAACGTTGG + Intronic
1043186094 8:77151555-77151577 CTGATTCAGCAGGTCTAGGGTGG + Intergenic
1044958744 8:97508478-97508500 GGGAGTCAGCTGATCTAGGCTGG + Intergenic
1045918980 8:107507826-107507848 CTGATTCAGTAGATCTGGGTGGG - Intergenic
1046858065 8:119057454-119057476 GAGAGGCACCTGATCTAGGTTGG - Intronic
1047692468 8:127370405-127370427 CTGATTCAGCTGGTCTAGGGTGG + Intergenic
1050051374 9:1605273-1605295 CTGATTCAGTAGATCTAGGATGG + Intergenic
1051476498 9:17514696-17514718 GACAGTCAGCTGATCTAGGCCGG - Intergenic
1052570690 9:30218315-30218337 CTGAGTCTGGTGATTTATGTTGG + Intergenic
1054349733 9:64010411-64010433 CTGATTCAGTAGATCTGGGTTGG + Intergenic
1054711331 9:68514098-68514120 CTGAGTCAGTAGATCTGGGTTGG - Intronic
1054775895 9:69123039-69123061 CTGATTCAGCAGATCTGGGTGGG - Intronic
1055097137 9:72425099-72425121 GGGATTCAGCTGATCTAGGCTGG - Intergenic
1056705870 9:88952443-88952465 CTGACTCAGCAGATCTAGGGTGG + Intergenic
1056715344 9:89023957-89023979 CTGACTCAGCAGATCTGGGGTGG + Intronic
1056955740 9:91079698-91079720 CTGATTCAGCAGATCTAGGGGGG - Intergenic
1057915591 9:99052958-99052980 CTGATTCAGCAGGTCTAGGGTGG - Intronic
1058068859 9:100581306-100581328 TTGATTCAGCTGATCTGGCTGGG - Intronic
1058983281 9:110189738-110189760 CTGAGTCAACAGGTCTGGGTGGG + Intergenic
1059000367 9:110342330-110342352 CTGAGTCAGCGGGTCCAGGGTGG - Intergenic
1059421155 9:114193254-114193276 CTGAGTCATCTGATCAGGTTTGG + Intronic
1059473224 9:114523060-114523082 CTGATTCAGCAGATCTGGGGTGG - Intergenic
1186105821 X:6204693-6204715 CTGAGTCAGCAGATCTGAGATGG - Intronic
1186404542 X:9290402-9290424 CTGATTCAGCAGGTCTAGGTCGG + Intergenic
1186806393 X:13144386-13144408 CTGATTCAGTAAATCTAGGTTGG - Intergenic
1186908840 X:14139860-14139882 CTGATTCAGATGATCTAGAGTGG + Intergenic
1187103044 X:16214647-16214669 CTGGGTCAGCAGATCTGGGATGG + Intergenic
1187670997 X:21665738-21665760 CTGAGCCAGTTGGTCTAGGGTGG - Intergenic
1188968542 X:36583917-36583939 GGGAGTCAGATGATCTAGGCTGG - Intergenic
1189422112 X:40865233-40865255 GTGATTCAGCTGATTTAGGCTGG - Intergenic
1192222284 X:69205601-69205623 CTGATTCAGCAGATCTAGGGTGG + Intergenic
1194425387 X:93731288-93731310 CTGAGTCAGTTGGTCTGGGATGG + Intergenic
1194598448 X:95889348-95889370 CAGAGTGAGTTGTTCTAGGTAGG - Intergenic
1196757900 X:119173931-119173953 CTGAGTCAACAGATCTGGGGTGG - Intergenic
1197671812 X:129285437-129285459 CTGATTCAGTTGTTCTAGGTGGG - Intergenic
1199900515 X:152167817-152167839 TAGAGTCATCTGATCTAGATGGG + Exonic
1201142965 Y:11043655-11043677 CTGATTCAGCAGGTCTGGGTGGG + Intergenic