ID: 1150187072

View in Genome Browser
Species Human (GRCh38)
Location 17:63194013-63194035
Sequence CCTCATCTACAGATGGAGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150187072_1150187081 17 Left 1150187072 17:63194013-63194035 CCCCCCTCCATCTGTAGATGAGG 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1150187081 17:63194053-63194075 ACTCGTCTGGGTTTCCTCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 119
1150187072_1150187080 5 Left 1150187072 17:63194013-63194035 CCCCCCTCCATCTGTAGATGAGG 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1150187080 17:63194041-63194063 AACACACTCATGACTCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 47
1150187072_1150187079 4 Left 1150187072 17:63194013-63194035 CCCCCCTCCATCTGTAGATGAGG 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1150187079 17:63194040-63194062 AAACACACTCATGACTCGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150187072 Original CRISPR CCTCATCTACAGATGGAGGG GGG (reversed) Exonic
903230363 1:21918621-21918643 CCTCCTCTATAGAATGAGGGTGG - Intronic
904807762 1:33143686-33143708 CCTCACCCACAGAATGAGGGAGG - Intergenic
904820002 1:33235879-33235901 CCTGACCAACAGAAGGAGGGAGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
910352794 1:86318793-86318815 CCTGGTCTAGAGATGGTGGGGGG + Intergenic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
916556836 1:165900620-165900642 CCAGATCTACAGAAGGAAGGGGG + Intronic
917460301 1:175223463-175223485 ACTCATCAACAGGTGAAGGGTGG + Intergenic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
921005751 1:211091726-211091748 CTTCATCCACAGAAGGAGGTAGG + Intronic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922551035 1:226494740-226494762 CCTCATACACAGACAGAGGGAGG + Intergenic
922726723 1:227926251-227926273 CCTCGTGTAAAGATGGAGGGTGG - Intronic
922799418 1:228358164-228358186 CCTGATCTGCTGATGCAGGGTGG - Intronic
923750305 1:236740942-236740964 CAACATCTACAGGTAGAGGGAGG - Intronic
923825073 1:237491384-237491406 CCTCATGTACAGAGTGAGTGGGG - Intronic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1065041976 10:21706398-21706420 CCTCATCTATAAAGTGAGGGTGG - Intronic
1070312124 10:75281556-75281578 CCCCAGCTGCAGATGGAGGTGGG + Intergenic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1073900747 10:108217417-108217439 CCTCACCTACAGGTGCAGGAAGG + Intergenic
1074112317 10:110431244-110431266 CCTCCTCTACTGCTGGTGGGAGG - Intergenic
1074854549 10:117463952-117463974 CCTCATACATGGATGGAGGGAGG + Intergenic
1075462922 10:122630739-122630761 CCTCACCTCCAGACGGAGAGGGG - Intronic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075626137 10:123965735-123965757 CCCCATCTACAGACAGAAGGGGG - Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1078464675 11:11541447-11541469 CCCCAACTACAGGTGGAAGGTGG - Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1080609992 11:33895548-33895570 CCTCATCTGCAGATGAAAAGTGG - Intergenic
1082794841 11:57371454-57371476 GCTCAACTGTAGATGGAGGGCGG + Intergenic
1083769314 11:64857553-64857575 CCTCATCTACAGGGTGAGGTGGG + Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085474187 11:76779344-76779366 CCACATCTACAGAGTCAGGGTGG + Intergenic
1085525641 11:77161947-77161969 CCTCCTCTGCACCTGGAGGGAGG + Intronic
1086244171 11:84731441-84731463 TCTCATCTAAAAATGGAGGTAGG + Intronic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087657303 11:100939837-100939859 CCTGAACTTCAGATGGAGGCGGG + Intronic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG + Intergenic
1096086076 12:48865858-48865880 CCTCCTCCTCAGTTGGAGGGAGG - Exonic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1101331176 12:103759004-103759026 CCTGATCTCCACATGGAGGCAGG + Intronic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102652200 12:114449869-114449891 CCTTTTCTCCAGATGGGGGGAGG - Intergenic
1103296720 12:119893172-119893194 GCTCATCAACAGATGAATGGGGG - Intergenic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1106539769 13:30679933-30679955 CCTAAATTACAGATAGAGGGAGG + Intergenic
1107559257 13:41545541-41545563 TCTCATCTTCACATGGAGGAGGG + Intergenic
1113639117 13:111944513-111944535 CCTCATCCACAGTTGCAGGGTGG + Intergenic
1120864364 14:89283427-89283449 GGACATCTCCAGATGGAGGGGGG - Intronic
1122134533 14:99625251-99625273 CCTCCTCTGCAGATGGGAGGAGG - Intergenic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128177279 15:65566958-65566980 CTTCATCTACACAAGGTGGGAGG - Intronic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1136624355 16:31452856-31452878 CCTCAGCTACCCATGAAGGGTGG - Intergenic
1138156691 16:54712262-54712284 CTTCATCTATAGAAGGAAGGAGG - Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139142412 16:64282868-64282890 CCTCATCTACATGCGGAGTGAGG - Intergenic
1140120854 16:72081954-72081976 GCTCATCAAAAGCTGGAGGGAGG + Intronic
1140671769 16:77286673-77286695 CCACATCTTCAGATGGGGGCAGG - Intronic
1141344681 16:83233885-83233907 CCTCATCTATACAAGGAGTGTGG - Intronic
1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG + Intronic
1141722641 16:85765317-85765339 CCTCAGCTGAGGATGGAGGGTGG + Intergenic
1141756289 16:85993335-85993357 TCTCATCAACAGCTGGATGGTGG + Intergenic
1142682490 17:1558528-1558550 CCTCATCTACAGACACAGGCAGG + Exonic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1148141892 17:45334850-45334872 CTTCATCTCCAGTTGGAGTGAGG + Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153171894 18:2326278-2326300 CTTCATTTACAGCTGGATGGAGG + Intergenic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1159274225 18:66194278-66194300 GCAGATCTACAGAAGGAGGGTGG - Intergenic
1160021376 18:75184315-75184337 CCTCATTTACACAAGGAGGGAGG + Intergenic
1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG + Intronic
1162128103 19:8510395-8510417 CCTCAACCACAGCTGGAGGTGGG + Exonic
1167116630 19:47492576-47492598 CCTCATCCACAGTGGGAGGGAGG - Intronic
924977051 2:187317-187339 CCTCATCTAAAGACTGAGGAAGG - Intergenic
927916471 2:26939829-26939851 ACTCATCTACAGAATGAGTGTGG - Intronic
928679104 2:33680755-33680777 CCTCCACTGCAGGTGGAGGGTGG + Intergenic
929432033 2:41895349-41895371 CCTCATTTCCATATAGAGGGTGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
933169912 2:79113851-79113873 CCTCATCTCCACATGGAAGCTGG - Intergenic
933389527 2:81652557-81652579 CCTCATCAACAGCTGGAAAGAGG - Intergenic
934691619 2:96365086-96365108 CGTGATCTAAAGATGGGGGGTGG - Intronic
938212213 2:129478167-129478189 CCAGATTTAAAGATGGAGGGAGG + Intergenic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
940004620 2:148999282-148999304 CTTCATCTACAGAAAGCGGGAGG - Intronic
941095576 2:161237438-161237460 CCTGCTCTACAGAGGGAGCGCGG + Intergenic
942161762 2:173196326-173196348 CCTGACCTACACAGGGAGGGAGG - Intronic
943198017 2:184780531-184780553 CCTTAATCACAGATGGAGGGAGG + Intronic
945682179 2:212927263-212927285 ACTCTTCTGCAAATGGAGGGAGG - Intergenic
946641351 2:221786691-221786713 CCCCATTTACAAATGCAGGGTGG + Intergenic
948643637 2:239390611-239390633 GCTCCTCCACAGGTGGAGGGTGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1172046072 20:32081151-32081173 CCTCATTTCCTTATGGAGGGAGG - Intronic
1174191655 20:48744787-48744809 CCTCAGCTCCACATAGAGGGTGG - Intronic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1175532942 20:59686367-59686389 CCTTTTCTAGAGTTGGAGGGAGG + Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1178473524 21:32916826-32916848 TCTCATCTACAAACTGAGGGTGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180317309 22:11285988-11286010 CCTAGTCTACAGGTTGAGGGTGG - Intergenic
1181866570 22:25861929-25861951 CCACAGATACATATGGAGGGTGG - Intronic
1181995089 22:26871468-26871490 TCTCATCTACTGTTGGTGGGAGG - Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182762530 22:32734329-32734351 CTTCATCTCCAGGTGCAGGGGGG + Intronic
1184682480 22:46079708-46079730 CCCCATCTACAGAAAGAAGGGGG - Intronic
1185135579 22:49070005-49070027 GCAGATCTACAGATAGAGGGTGG - Intergenic
1185349230 22:50326023-50326045 GCCCACCTGCAGATGGAGGGAGG - Intronic
1185368861 22:50449836-50449858 CATCATTTGCATATGGAGGGAGG - Intronic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
951742792 3:25942797-25942819 TCTCATCTACTGCTGGTGGGAGG - Intergenic
953208087 3:40849657-40849679 TTTCATCTCCAGAAGGAGGGAGG + Intergenic
954385657 3:50242522-50242544 CCTCAGCTACAGGTGCAGGGTGG + Intronic
954903517 3:54040712-54040734 CCTTATCCTTAGATGGAGGGTGG - Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
960953209 3:123012861-123012883 TTTCTTCTACAGATGGATGGAGG + Intronic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
962485663 3:135839834-135839856 CCTCAAATAGAGATGGAGTGTGG - Intergenic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
966865702 3:184258168-184258190 CCTGAGCTACAGATGTGGGGTGG + Intronic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985915899 5:2919076-2919098 TCTCATCTCCACATGCAGGGTGG + Intergenic
987061159 5:14245439-14245461 CTTCATCTACAAGTGGAGGAGGG - Intronic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
994508936 5:100678695-100678717 TCTCATCTAAAGATGGAGCTTGG + Intergenic
995388864 5:111616911-111616933 TCTCATCTACAGGTGAAGGTGGG - Intergenic
996709088 5:126526127-126526149 CCTCTTCTACAGCAGGAAGGAGG - Intergenic
998624729 5:143833412-143833434 CCATATCTACAAATGAAGGGGGG - Intergenic
998649675 5:144103994-144104016 CCTCATTTACAAATGAAGTGAGG - Intergenic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1003761149 6:9180353-9180375 CCTCATCCCCTGATGGAGGGAGG + Intergenic
1004978927 6:21000559-21000581 TGTCATGTACAGATGGAAGGTGG - Intronic
1006682571 6:35807681-35807703 CCTCATCTATAGTTGGGGGGTGG - Intronic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1013400807 6:109794534-109794556 CCACAGATACTGATGGAGGGAGG - Intronic
1015258727 6:131210357-131210379 CCTCAACTACAGATAAAGTGAGG - Intronic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1018882097 6:167894246-167894268 CCTATTCTACAGATGAAGGGAGG - Intronic
1019435361 7:1019779-1019801 CCTCTTCTCCTGATGGAGTGTGG + Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1020222972 7:6255607-6255629 CCTCATCAAGATAGGGAGGGAGG + Intronic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020745371 7:12072703-12072725 CCTCATCAAAAGCTGGAAGGAGG + Intergenic
1023728432 7:43167479-43167501 CAACAACTCCAGATGGAGGGAGG + Intronic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1032926818 7:136615596-136615618 CCTGTTCTACAGCTGGAGGCAGG + Intergenic
1033348678 7:140544644-140544666 CCTCCTCTCCAGAAGCAGGGAGG + Exonic
1034164520 7:149015098-149015120 CCTCATCTGCTTCTGGAGGGAGG - Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1037871953 8:22506395-22506417 CCACATCTTCAGATGAAGAGTGG - Intronic
1039762227 8:40590025-40590047 CCTCATCTAAAAAGGAAGGGAGG - Intronic
1042346720 8:67734991-67735013 CCTCATCTAGTGATAGAGTGTGG + Intronic
1044102905 8:88162787-88162809 GCACATCTACACATGGTGGGAGG - Intronic
1045683120 8:104683637-104683659 CATCATCCACAGATTGTGGGAGG + Intronic
1045926235 8:107580975-107580997 CCTAATATACAGAGGGAGAGAGG + Intergenic
1048179546 8:132182487-132182509 CCTCATCTCCCCAGGGAGGGTGG + Intronic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG + Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1060208475 9:121696529-121696551 CCTCTTCGCCAGATGAAGGGAGG - Intronic
1061440436 9:130599621-130599643 CCTGATCCAAAGCTGGAGGGCGG - Intronic
1061817904 9:133207326-133207348 TGTCATCTACAGATGGGGGCAGG - Exonic
1062242495 9:135547859-135547881 TGTCATCTACAGATGGGGGCAGG + Exonic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186611907 X:11145952-11145974 TCACATCTACAGATTGAGAGAGG - Intronic
1193469657 X:81884310-81884332 CCTCATCTAATGATTTAGGGAGG + Intergenic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1200767460 Y:7092475-7092497 CCTCATCGAAAGGTGGAAGGGGG - Intergenic
1201305041 Y:12542642-12542664 CCTCATCTGCAGGTTGCGGGTGG + Intergenic