ID: 1150187243

View in Genome Browser
Species Human (GRCh38)
Location 17:63196127-63196149
Sequence TGTAATGTAATATCAGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150187243_1150187245 -9 Left 1150187243 17:63196127-63196149 CCATTAACTGATATTACATTACA 0: 1
1: 0
2: 2
3: 13
4: 278
Right 1150187245 17:63196141-63196163 TACATTACATGTTTAGTTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 224
1150187243_1150187246 -8 Left 1150187243 17:63196127-63196149 CCATTAACTGATATTACATTACA 0: 1
1: 0
2: 2
3: 13
4: 278
Right 1150187246 17:63196142-63196164 ACATTACATGTTTAGTTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 176
1150187243_1150187244 -10 Left 1150187243 17:63196127-63196149 CCATTAACTGATATTACATTACA 0: 1
1: 0
2: 2
3: 13
4: 278
Right 1150187244 17:63196140-63196162 TTACATTACATGTTTAGTTGTGG 0: 1
1: 0
2: 1
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150187243 Original CRISPR TGTAATGTAATATCAGTTAA TGG (reversed) Intronic
901583454 1:10265534-10265556 TGTGTTTTAAAATCAGTTAAAGG - Intronic
901612886 1:10513053-10513075 TGTATTCTAATATAAGTCAAAGG - Intronic
905059300 1:35125556-35125578 AGTAGTGTAATATCAATTGAAGG - Intergenic
906234771 1:44199394-44199416 TGTAATGTAATTTTGTTTAAAGG - Intergenic
908080391 1:60571388-60571410 TGTAATGAAACATCATTGAAGGG + Intergenic
908337438 1:63141701-63141723 TGTAATCTAATATTTTTTAAAGG - Intergenic
908608593 1:65828715-65828737 AGTGATGTAATATTATTTAAAGG + Intronic
908617106 1:65933900-65933922 TGTAATTAAATATTATTTAAAGG + Intronic
908875910 1:68675383-68675405 TGTAATATGAAATAAGTTAATGG - Intergenic
909888335 1:80971090-80971112 GGCAATGTAAGATCAGTAAAAGG + Intergenic
912377656 1:109224786-109224808 TGTAATGTAATATGATTAAGGGG - Intronic
912868193 1:113278046-113278068 TATAATGTAATGTCAGGGAAAGG + Intergenic
916779606 1:168010456-168010478 TGGAATTTAAAATCAGTTGATGG + Intronic
918628889 1:186691600-186691622 TGAAATGTAATATCTATAAAAGG - Intergenic
918881061 1:190121957-190121979 TGTAATGTAATATGAATAAGTGG + Intronic
922509778 1:226154730-226154752 AGTAATATGATGTCAGTTAATGG - Exonic
923322219 1:232845873-232845895 TGTAATGGAGTTTCAATTAATGG + Intergenic
923693324 1:236219617-236219639 TTTTATGAAATACCAGTTAATGG + Intronic
923768663 1:236917360-236917382 AGTGATGTAATATCACTTGAAGG + Intergenic
1063614524 10:7590316-7590338 AGTAAAGGAATATCAGTTTATGG - Intronic
1064039139 10:11943370-11943392 TGTATTGTTAGATCAGTTGAAGG - Intronic
1065843013 10:29720788-29720810 AGTGATATAATATCACTTAAAGG + Intronic
1066601642 10:37114490-37114512 AGTGATGTAATATCATTTGAAGG - Intergenic
1066942469 10:41889078-41889100 TGTAATGTAATGTAATGTAATGG + Intergenic
1066968664 10:42295421-42295443 TGTAATGTAATGTAATGTAATGG - Intergenic
1066969578 10:42302158-42302180 TGTAATGTAATGTAATGTAATGG - Intergenic
1068327773 10:55516883-55516905 TGTAATTTTATATCAGCTAATGG + Intronic
1068329327 10:55540643-55540665 TGTTATGTAATATCAATTAAAGG + Intronic
1068725147 10:60292563-60292585 TTTAATAAAATAGCAGTTAATGG + Intronic
1069101971 10:64333447-64333469 AGTAATCTAATATCAATTAAAGG - Intergenic
1069118068 10:64533341-64533363 TTTAAGATAATATCAGTTTAGGG + Intergenic
1072457440 10:95589079-95589101 TGAACAGTAATTTCAGTTAAGGG - Intergenic
1074218688 10:111413955-111413977 AGTAGTATAATATCAGTTGAAGG + Intergenic
1075794311 10:125107876-125107898 CGTAATATAATAAAAGTTAAGGG + Intronic
1079161457 11:17998665-17998687 TGGAATGCAATAAAAGTTAAAGG + Intronic
1081195854 11:40159771-40159793 TATAATGTAATTTCAGGGAAAGG - Intronic
1081319015 11:41667790-41667812 TGTAATATAATACCATATAATGG + Intergenic
1082267318 11:50132922-50132944 TTTAATGAAATAACAGTTCAGGG + Intergenic
1082288769 11:50345646-50345668 TTTAATGAAATAACAGTTCAGGG - Intergenic
1082761867 11:57135226-57135248 AGTGATGCAATATTAGTTAAAGG + Intergenic
1084556453 11:69879006-69879028 TGTAAAGCAATGTCAGTTCAAGG + Intergenic
1088228597 11:107649089-107649111 TTTAATGTAATATTAATGAATGG + Intronic
1088524894 11:110741851-110741873 TGTAATGAATCATCAATTAAAGG - Intergenic
1090430238 11:126639945-126639967 TGTAATTTAGCATAAGTTAATGG - Intronic
1090901953 11:131039810-131039832 TGTATTGTAAGAGCATTTAAGGG - Intergenic
1091145741 11:133278411-133278433 TGAAAAGTAATATCAATGAAAGG + Intronic
1094647435 12:32339340-32339362 TTTAATGTAATTTCCGTAAAGGG + Intronic
1095203636 12:39414331-39414353 AGTAATGTAATAACCATTAATGG - Intronic
1095582241 12:43813577-43813599 TGTAATGTTATCTCAGAGAAAGG - Intergenic
1098165608 12:67694493-67694515 TGTAATGTATTAGCAGTTCCAGG - Intergenic
1098930421 12:76405944-76405966 TGTAAGGGGATAGCAGTTAAAGG - Intronic
1100085927 12:90910727-90910749 TGTAATGTGATATCACCTTATGG - Intronic
1100703502 12:97175227-97175249 CGTAATGACATTTCAGTTAACGG - Intergenic
1100882983 12:99038929-99038951 TGTAATATGATATCAGCTAGTGG - Intronic
1101162148 12:101988963-101988985 TATAATTTAAAATCAGGTAATGG + Intronic
1105253106 13:18718767-18718789 TGTATTTTAATATTATTTAATGG + Intergenic
1105289341 13:19038710-19038732 TGTAATGATATCTCAGTTCATGG + Intergenic
1105318521 13:19292077-19292099 TGTAAAGTAATATCTGGTTATGG - Intergenic
1105715864 13:23064268-23064290 TGTAATTAAGTATTAGTTAAGGG - Intergenic
1105736067 13:23272130-23272152 TATAAAGTAAAATCAGTTAGAGG - Intronic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1106493381 13:30249917-30249939 TGTAATTTAATATTTATTAATGG - Intronic
1106910006 13:34453571-34453593 TGTAATATAAAATCAGAAAATGG + Intergenic
1106944088 13:34806187-34806209 TCTAATTTAATATCACTTAGAGG - Intergenic
1107728603 13:43325453-43325475 TGTAATTTAGCATTAGTTAATGG + Intronic
1107802194 13:44119173-44119195 TACAATGGAATATTAGTTAAGGG - Intergenic
1108236222 13:48409016-48409038 TGAAGTGTAATATCAAATAAAGG + Intronic
1109065497 13:57683530-57683552 TATAGTACAATATCAGTTAAAGG - Intronic
1109107361 13:58271996-58272018 TGTGATGTAATATATGTAAAAGG - Intergenic
1109791609 13:67255663-67255685 TGTAGTGTAATATATATTAAAGG - Intergenic
1110107418 13:71695052-71695074 TCTAATGTAATGTTAGTTACAGG - Intronic
1111381717 13:87462527-87462549 TGTAATGAAATATATGGTAAAGG - Intergenic
1111580942 13:90222989-90223011 TATAATGTAATATAAATGAAGGG - Intergenic
1111653220 13:91119528-91119550 GGTAATATTTTATCAGTTAATGG + Intergenic
1111869623 13:93814239-93814261 TGTCAAGTAATATTTGTTAATGG - Intronic
1111984079 13:95047851-95047873 TGTAATATAATATTAGGTACTGG - Intronic
1113108895 13:106800854-106800876 TTGAATGTTATATCAATTAATGG - Intergenic
1113402677 13:110008667-110008689 TTAAATGTAGTATCATTTAAAGG + Intergenic
1114870728 14:26653977-26653999 TATAATATAATAGCTGTTAAAGG - Intergenic
1117148484 14:52860216-52860238 TCTATTGTAATATGAGTTAATGG + Intronic
1117747745 14:58888316-58888338 TTTAATGGAATATAAGCTAATGG + Intergenic
1117924507 14:60764150-60764172 TGTTATGTAATATTTGTTAGTGG + Intronic
1118555792 14:67019697-67019719 TGTACTGTAACACCAGTTAGTGG - Intronic
1120128403 14:80775096-80775118 TCTAATAAGATATCAGTTAATGG - Intronic
1120154053 14:81071866-81071888 TGAAATGTAATATTACTGAAAGG - Intronic
1121432400 14:93896994-93897016 TGTCATGTAATATCAGTGGTGGG - Intergenic
1121564353 14:94897405-94897427 TGCAATGAAATATCAGGGAAAGG + Intergenic
1122436004 14:101699676-101699698 TATAATTTAAAATCAGGTAATGG - Intergenic
1125037706 15:35145354-35145376 TGTAAAGGAATTTCAGTTAAAGG - Intergenic
1125318335 15:38456089-38456111 TGTCATGTAAAATAAATTAATGG + Intronic
1126762111 15:51978783-51978805 TGTAATGTAATCTATGTTATAGG - Intronic
1128025552 15:64433623-64433645 ACTTATGTAATGTCAGTTAATGG + Intronic
1131217582 15:90551902-90551924 TGTAATGTAATGTAATGTAAGGG - Intronic
1131299565 15:91185053-91185075 TCCAATTGAATATCAGTTAAAGG + Intronic
1134466536 16:14483807-14483829 TGTAGTGTAATTCCAGTTATAGG - Intronic
1136717423 16:32293311-32293333 AGTGATGTAATATCATTTGAAGG - Intergenic
1136835797 16:33499574-33499596 AGTGATGTAATATCATTTGAAGG - Intergenic
1137091529 16:36197604-36197626 TTGAATGGAATATCATTTAATGG - Intergenic
1139129202 16:64119640-64119662 TGTAATGTAATAAGAGTTATGGG - Intergenic
1139262830 16:65611399-65611421 TGTAATGTAATGGAAGTTAATGG + Intergenic
1203009006 16_KI270728v1_random:224463-224485 AGTGATGTAATATCATTTGAAGG + Intergenic
1203145976 16_KI270728v1_random:1799909-1799931 AGTGATGTAATATCATTTGAAGG - Intergenic
1144111333 17:12036917-12036939 TGTAGTATATTATCAGTTCATGG + Intronic
1144168019 17:12631697-12631719 TTTAATTTAAAATCAGGTAAAGG - Intergenic
1144886980 17:18469894-18469916 TGGAATATAATAGCAGTTGAGGG + Intergenic
1145145235 17:20474401-20474423 TGGAATATAATAGCAGTTGAGGG - Intergenic
1145332264 17:21882647-21882669 TGTAATGTAATGTAATGTAATGG + Intergenic
1145344609 17:21981065-21981087 TGTAATGTAATGTAATGTAATGG + Intergenic
1145344687 17:21981657-21981679 TGTAATGTAATGTAATGTAATGG + Intergenic
1145345551 17:21987998-21988020 TGTAATGTAATGTAATGTAATGG + Intergenic
1146120926 17:30193722-30193744 TGTAATGATATATCAGTAACAGG + Intergenic
1146389396 17:32407540-32407562 TATAAAGTAATATCAGTTTGTGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148859005 17:50594282-50594304 TGTTATTTAGTATCAATTAATGG - Intronic
1150013992 17:61535108-61535130 TCAAATGTAATCTCAGTTTATGG + Intergenic
1150187243 17:63196127-63196149 TGTAATGTAATATCAGTTAATGG - Intronic
1203176233 17_KI270729v1_random:21415-21437 TGTAATGTAATGTAATGTAATGG + Intergenic
1203188573 17_KI270729v1_random:154402-154424 TCGAATGGAATATCATTTAATGG - Intergenic
1154214291 18:12404504-12404526 TGTAATTTAAAACCAGTGAAAGG + Intergenic
1154474246 18:14739176-14739198 AGTGATGTAATATCATTTGAAGG - Intronic
1155722691 18:29037303-29037325 TGTAATGCACTATCTGTTTAGGG + Intergenic
1157797702 18:50590273-50590295 TTTAATTGAATTTCAGTTAACGG + Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158779602 18:60631480-60631502 TGTTACGTAAAATCAGTAAATGG + Intergenic
1159163684 18:64675975-64675997 TATAATGTAAAATCAATTTAAGG - Intergenic
1159682296 18:71370062-71370084 ATTAATGTATTATTAGTTAATGG + Intergenic
1166578020 19:43863339-43863361 TGTAATGTAATAACTTTTCACGG - Intergenic
1167274082 19:48525015-48525037 TGTTTTGAAATATCAGTTATAGG + Intergenic
1168546747 19:57258566-57258588 TGTAACATAATTACAGTTAATGG + Intergenic
925052274 2:825368-825390 TTTAAAGCAATATAAGTTAATGG + Intergenic
925320053 2:2958419-2958441 TCTAATGTAATATTAGTGCAAGG + Intergenic
930215944 2:48697484-48697506 TGTTTTGGAAGATCAGTTAATGG + Intronic
930399518 2:50865285-50865307 TGTAATGAAATATAAATTACAGG - Intronic
931168919 2:59781573-59781595 TGTAATGCATTATCAGTAGAAGG - Intergenic
931592779 2:63903683-63903705 AGTAATGTCATATTATTTAAAGG + Intronic
933062178 2:77751872-77751894 AGTGATGTAATATCACTTGAAGG - Intergenic
933875600 2:86618280-86618302 TTTAATATAACATCAGTTAGTGG - Intronic
934195059 2:89831907-89831929 TGTAATGTAATGTAATGTAATGG - Intergenic
934637698 2:96006093-96006115 TGAAATTTAATGTCAGTGAAGGG + Intergenic
934795961 2:97099318-97099340 TGAAATTTAATGTCAGTGAAGGG - Intergenic
935922059 2:108026513-108026535 TGAAATGTAATGTCAGTTTCAGG + Intergenic
938180949 2:129181789-129181811 TGTGATATAATCTCACTTAAGGG - Intergenic
939483737 2:142782000-142782022 TTTGATGTAATATCAAATAATGG - Intergenic
940258232 2:151754846-151754868 TGTAATGTAACATAATATAATGG - Intergenic
940511593 2:154622495-154622517 TCAAATGTAATAACAGATAAAGG - Intergenic
941740224 2:169028142-169028164 TGTACTGTGAGATCAGTTCAGGG + Intronic
941788627 2:169526019-169526041 TGTAATAGAAAATCAGTTTAAGG - Exonic
942914517 2:181287305-181287327 TGTTATTTAAAATTAGTTAAAGG - Intergenic
942925882 2:181431651-181431673 TGTAAGGAAATATCAGTTTTCGG + Intergenic
943617612 2:190111420-190111442 ATTAATGTAATATCACTTGATGG - Intronic
944300466 2:198118866-198118888 ATTAATGTAATAATAGTTAAAGG - Intronic
944966201 2:204936973-204936995 TGAAATGTGAAAACAGTTAAAGG + Intronic
946814357 2:223561129-223561151 TGTCATGTCATTTCAATTAATGG - Intergenic
947929591 2:233952632-233952654 TGTAATGGGATATCATTAAAAGG + Intronic
1170233577 20:14077151-14077173 TGTAATGTAATGTAAGTCTAAGG - Intronic
1172379723 20:34478816-34478838 TGTAATTTTGTATAAGTTAAAGG + Intronic
1173623236 20:44452288-44452310 TGTAATTTAATACAAGTAAAAGG + Intronic
1174823823 20:53750692-53750714 TGCAATGTAATATCAGATATAGG + Intergenic
1176750317 21:10685979-10686001 TGTAATGTAATAGAAAGTAATGG - Intergenic
1178194299 21:30325813-30325835 TGTAATTTAATATGAGTCCAAGG + Intergenic
1178563676 21:33663336-33663358 TATAATTTTATAACAGTTAATGG - Intronic
1180282934 22:10719582-10719604 TGTAATGGAATGTAATTTAAAGG - Intergenic
1180283681 22:10724920-10724942 TGTAATGGAATGTAATTTAAAGG - Intergenic
1180690643 22:17712324-17712346 TGTAATGTAATGTCACTAACAGG - Intronic
1182190338 22:28453537-28453559 TTTTATTTTATATCAGTTAATGG + Intronic
1203304731 22_KI270736v1_random:101256-101278 TGCAATGGAATATAATTTAATGG + Intergenic
949405664 3:3711830-3711852 TGCAATGTAATCAGAGTTAAGGG + Intronic
949405972 3:3715215-3715237 TGTAAGGTAATATATGTTCATGG - Intronic
951169370 3:19521862-19521884 TTTATTGTAATATCAGGTAATGG - Intronic
951197232 3:19837905-19837927 TGTAATATAATATCAGGTAGTGG - Intergenic
951443823 3:22753678-22753700 TGTAATGTGATATCATGTATGGG + Intergenic
951905738 3:27705114-27705136 TATAATATAATATCACTTGAAGG - Intergenic
952718320 3:36505635-36505657 TGCAATGTAATTTCAGTGTATGG - Intronic
953586251 3:44203828-44203850 TGAAATGTGTTCTCAGTTAAGGG - Intergenic
954049370 3:47960570-47960592 TATAATGAAGTATCATTTAAAGG - Intronic
955051986 3:55421365-55421387 GGTAATGTAGTATTAGTTCAAGG + Intergenic
957460973 3:80520241-80520263 TTTAATATAATATCAGTTAAAGG + Intergenic
957464410 3:80568336-80568358 TGTAATGAAGTTTCAGTTTATGG - Intergenic
957664197 3:83202665-83202687 TGTTATTTAAATTCAGTTAATGG + Intergenic
957710840 3:83857591-83857613 TGTAATCTAATAAGAGTTATTGG + Intergenic
959342885 3:105153319-105153341 TTTAATGTAATATCAGAAAGGGG + Intergenic
960186399 3:114645772-114645794 TCTAATGAAATATCTGGTAAAGG - Intronic
962130643 3:132670432-132670454 TGTATTAGAATATCATTTAAAGG + Intronic
964139944 3:153386421-153386443 TGTTATGTAATATCCGTAACTGG - Intergenic
965224345 3:165969505-165969527 TGTAATGTTATATATGTGAAAGG - Intergenic
966418344 3:179713329-179713351 TGTAATTTCATATTAGTTTATGG + Intronic
966622296 3:181978577-181978599 TGGAATGTAATATTAGTAGAAGG + Intergenic
971151266 4:24034226-24034248 TGTAATGTAAAGTAAGTTAGAGG + Intergenic
973167456 4:47095154-47095176 TTTTATGTAAAATCTGTTAAAGG - Intronic
973654294 4:53030067-53030089 TGCAAAATAATATCTGTTAAAGG + Intronic
974339052 4:60590039-60590061 TATAATGTAATCTTTGTTAATGG - Intergenic
974706658 4:65526562-65526584 TGTAAAATAAGATAAGTTAATGG + Intronic
975343802 4:73271381-73271403 AGTAATGTAATACCACTTGAAGG - Intergenic
978067102 4:104418812-104418834 GGTAATGTAATATGAATTTAAGG - Intergenic
979083028 4:116367010-116367032 TGAAATGTAAAGTCAGTTATGGG + Intergenic
979167878 4:117559200-117559222 TGTAATGTAAAAACAGTTCCTGG + Intergenic
979187919 4:117822227-117822249 CGTAATGTAATATTTGTTACTGG + Intergenic
980193956 4:129563970-129563992 TGTAGTGGAATATGAGTTATTGG - Intergenic
980641091 4:135580920-135580942 TGTTATGAAAAATCAATTAAGGG + Intergenic
981519279 4:145645029-145645051 TGCAATGTAAGCTGAGTTAATGG - Intronic
981895344 4:149792454-149792476 TGTAAAGTATTATAATTTAAAGG + Intergenic
983816274 4:172130855-172130877 TGTAATGAAATATCTCTTTATGG - Intronic
984549473 4:181143404-181143426 CGCAATGTAATATCACATAAAGG - Intergenic
984565362 4:181323522-181323544 TCTGATGCAATATCAGTTCATGG - Intergenic
987247866 5:16067406-16067428 TGCAATGTAATTGCAGTGAATGG - Exonic
987926009 5:24342811-24342833 TTTAATGAAATATCATTGAAAGG + Intergenic
988193725 5:27972251-27972273 TTTGATATAATATCAGGTAATGG - Intergenic
988250828 5:28755717-28755739 TGTAATTTATTAGCATTTAAAGG + Intergenic
989498212 5:42134214-42134236 TGTAATACAATAACAGTTGAGGG + Intergenic
993272598 5:85814233-85814255 TTTAACGTAATATAACTTAAAGG + Intergenic
993462614 5:88202732-88202754 TGTAAGGTAATATTAGTGCAAGG + Intronic
994011477 5:94908235-94908257 TGTAATGTAGTATTAGATTACGG + Intronic
994598750 5:101874062-101874084 TATATTGTAATATCTCTTAAGGG + Intergenic
994897062 5:105720401-105720423 AGTAATATAATGTCACTTAAAGG + Intergenic
996249140 5:121305484-121305506 CTTAATGTAATAACATTTAATGG - Intergenic
996990829 5:129628667-129628689 TGTAATGACATTTCAGTCAATGG + Intronic
997729013 5:136151248-136151270 GATAATGTAATATCAGATTAGGG + Intronic
997866805 5:137471018-137471040 TTAATTGTAATATGAGTTAACGG + Intronic
999519620 5:152337848-152337870 TGTTATCTAATGTCAGGTAAGGG + Intergenic
1000206592 5:159066220-159066242 TGTAATATAATATAAAGTAATGG - Intronic
1000816183 5:165924971-165924993 TGTAATGTAATATCTACTACTGG + Intergenic
1003205010 6:4000768-4000790 TATCATGTATTGTCAGTTAAAGG - Intergenic
1007815094 6:44516499-44516521 TGTAAAGTATAATCAGTAAAAGG - Intergenic
1007999533 6:46344616-46344638 AGTAATGTAATATTAGTTTAAGG + Intronic
1008655623 6:53610376-53610398 TGTAATATAAAATCAGTATAAGG + Intronic
1009376213 6:62973269-62973291 TGTAAAGCAATAATAGTTAAAGG + Intergenic
1009416383 6:63420345-63420367 TGGAATGGCATATCAGTTGAGGG - Intergenic
1010144531 6:72651723-72651745 TGATATGTAATATCATTTTAAGG - Intronic
1015371977 6:132464649-132464671 TGGAATGTAATTTAAGTTACTGG + Intronic
1015414556 6:132933766-132933788 TGTAAAGTAAAATTAGTTCATGG - Intergenic
1017382033 6:153842528-153842550 ACTAATGTAATATCAGTAACGGG + Intergenic
1017527573 6:155255261-155255283 TGTAATGCCATCTAAGTTAAGGG + Intronic
1017533494 6:155321635-155321657 TGTAATATAATATAATTTCAGGG + Intergenic
1018347586 6:162918245-162918267 TGTAATTTAGTATTAGCTAATGG - Intronic
1020514741 7:9104279-9104301 AGTGATATAATATCACTTAAGGG - Intergenic
1024008702 7:45248427-45248449 TGTCATTTAAAATCAGTTAGGGG - Intergenic
1024609386 7:51050954-51050976 TGTAATTTAATATAAAATAATGG - Intronic
1024823456 7:53361562-53361584 AGTAATGTAATTTCAGTGCATGG + Intergenic
1028017477 7:85734399-85734421 TGTAATCTAATCTCAGGTGAAGG + Intergenic
1028219527 7:88180568-88180590 TTTAATGGAATATTGGTTAATGG - Intronic
1028950917 7:96633492-96633514 TTTAATGTCCTATCAGATAAAGG + Intronic
1031451976 7:121932680-121932702 TGTAATGTAATATTTCTAAATGG - Intronic
1031638351 7:124130124-124130146 TTTAATGTAATATAAGGGAAAGG + Intergenic
1034181582 7:149142835-149142857 TGGAATGTAAAATCAGTAAACGG + Intronic
1035909733 8:3553188-3553210 TGCAATGTAATATCACTTCATGG + Intronic
1036069681 8:5426919-5426941 TGTTATGTATCATGAGTTAATGG - Intergenic
1036521660 8:9497499-9497521 AGCAATTTCATATCAGTTAATGG + Intergenic
1038378975 8:27074433-27074455 GCTACTGTAATTTCAGTTAAAGG - Intergenic
1041561238 8:59221185-59221207 TGAAATATAATATTAGTTGAAGG + Intergenic
1041843894 8:62304945-62304967 TGTAATGAAATCTCAGTTCTAGG + Intronic
1042586294 8:70342992-70343014 TGAAATAGAATATAAGTTAATGG - Intronic
1043246259 8:78005871-78005893 TGCAATGGAATAGCAGTTACTGG - Intergenic
1043799115 8:84584707-84584729 TATAAAATAATATTAGTTAATGG - Intronic
1043964669 8:86460537-86460559 TGTAATATAATAGCTATTAAGGG - Intronic
1044097044 8:88079619-88079641 TGTTATGTAATTTCAGTCAGAGG - Intronic
1044167888 8:89010745-89010767 TGTAATGTTATATGAGCTGAAGG - Intergenic
1045599854 8:103700850-103700872 AATAGTGTAATATCAGTTGAAGG - Intronic
1046283994 8:112072433-112072455 TGTAATGTCATATAATTTTAAGG + Intergenic
1046305713 8:112363817-112363839 TGCAATGTATTCTGAGTTAATGG + Intronic
1046741901 8:117837934-117837956 AGCAATGTAATATCATTAAATGG - Intronic
1047173978 8:122522963-122522985 CTTAATGTAGTATCAGTCAAAGG + Intergenic
1048554556 8:135461707-135461729 TGTTATGTAATCTTATTTAATGG - Intronic
1050842102 9:10163381-10163403 TAAAATGTTATAACAGTTAAAGG - Intronic
1051240155 9:15046535-15046557 TGTAATGTAATTTCAATTTCAGG + Intergenic
1052873610 9:33533788-33533810 TGTAATCTTATATTAGCTAAAGG + Intronic
1053389347 9:37723102-37723124 TGTAATGAAATATCACCAAAGGG - Intronic
1053502482 9:38610949-38610971 TGTAATCTTATATTAGCTAAAGG - Intergenic
1055419273 9:76120648-76120670 TATAATATAATGTGAGTTAAAGG - Intronic
1057153609 9:92818689-92818711 TGTAATCTTATATTAGCTAAAGG + Intergenic
1057682314 9:97200184-97200206 TGTAATCTTATATTAGCTAAAGG - Intergenic
1057728943 9:97591939-97591961 ATTAATGTAATCTCAATTAAAGG + Intronic
1058144545 9:101397465-101397487 TGTAATGTAATTTCAGAAAGTGG - Intronic
1058631520 9:106993126-106993148 TAGAATGTATTTTCAGTTAAAGG + Intronic
1186845314 X:13524993-13525015 TGTAATGTGATATCAGGACATGG + Intergenic
1188310816 X:28614381-28614403 TTTAATGAAATATCTGCTAAAGG - Intronic
1188369425 X:29350339-29350361 TGAAATATAATAGCAGTGAAGGG - Intronic
1188381241 X:29495459-29495481 CGTAATCTAATCTCAGCTAATGG + Intronic
1188392715 X:29640834-29640856 TGTAATGTAATTTGTGTTTAAGG - Intronic
1188475207 X:30584864-30584886 TGAAATATGATATAAGTTAAAGG + Intergenic
1188779431 X:34262668-34262690 TATTATGTAATCTCAGTTATAGG + Intergenic
1192311820 X:70022655-70022677 TGTAATTTACTATAAGTTAATGG - Intronic
1192490768 X:71575486-71575508 TTGATTGAAATATCAGTTAAAGG + Exonic
1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG + Intergenic
1194149074 X:90300992-90301014 TGTAATGTTTTTTAAGTTAATGG - Intergenic
1194428290 X:93767206-93767228 TATAATGAAATATCAGGAAAAGG + Intergenic
1196318548 X:114260035-114260057 TGTAATGTAAAAACATTAAAAGG + Intergenic
1197626008 X:128803266-128803288 TCTCATGTAATAGCTGTTAATGG + Intergenic
1198296075 X:135288032-135288054 TGTTATCTCATATCACTTAATGG - Intronic
1198417514 X:136435568-136435590 AGTAATGTAAGAACAGTAAAAGG + Intergenic
1200495446 Y:3877724-3877746 TGTAATGTTTTTTAAGTTAATGG - Intergenic
1201127553 Y:10928538-10928560 TGTAAGGTAATGTAATTTAATGG - Intergenic
1201136215 Y:10992051-10992073 TGTAATGTAATGTAATCTAATGG - Intergenic
1201138869 Y:11011517-11011539 TGTAATGTAATGTAATGTAATGG - Intergenic
1201199485 Y:11526410-11526432 TGTAATGTAATAGCCTCTAATGG + Intergenic