ID: 1150189847

View in Genome Browser
Species Human (GRCh38)
Location 17:63226775-63226797
Sequence AGGAGGGGAACACCACCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150189847 Original CRISPR AGGAGGGGAACACCACCACT GGG (reversed) Intronic
900029415 1:359964-359986 AGGAGGGAAACACCAACCCGAGG + Intergenic
900550467 1:3252043-3252065 TGGAGGGGAACCCCGCCACCCGG - Intronic
900581491 1:3412011-3412033 AGGACGTCAACACCACCACGGGG + Exonic
900784776 1:4642157-4642179 AGGAGGGGAACGCTGACACTTGG - Intergenic
902167786 1:14586205-14586227 ATGAGGTGAAAACCTCCACTAGG - Intergenic
904899318 1:33843945-33843967 AGGTGGCCTACACCACCACTAGG - Intronic
908732766 1:67243482-67243504 AGGAGGGGAACATCACACATTGG - Intronic
908830316 1:68172131-68172153 GGGAGGGGAACATCACACCTGGG + Intronic
910349594 1:86280595-86280617 AGGAAGGGAATGCCACAACTTGG + Intergenic
911682040 1:100728083-100728105 AGAAAGGGAACACCACATCTTGG - Intronic
912607210 1:111003509-111003531 AGGAGAGGAACATCACAACCCGG + Intergenic
916521466 1:165567276-165567298 AGGAGGAGAAAACCACCACATGG + Intergenic
917013686 1:170504813-170504835 AGGAGGGGAACATCACACATAGG - Intergenic
920563394 1:206955509-206955531 AGGAGGCCACCTCCACCACTTGG - Intergenic
923029422 1:230235520-230235542 AGGAAGGGAAAACCTCCAGTGGG + Intronic
924634768 1:245775171-245775193 AGGTGGGGGACACCCCCACCCGG + Intronic
1064543543 10:16428909-16428931 ACAATGGGAACACCACCATTTGG + Intergenic
1066648628 10:37635207-37635229 AGAAGGGGGACAGCACCACGTGG - Intergenic
1067031504 10:42880894-42880916 AGGAGGGGGCCAGCACCACGTGG - Intergenic
1067479840 10:46587521-46587543 TGTAGGGGCCCACCACCACTCGG - Exonic
1067614897 10:47754276-47754298 TGTAGGGGCCCACCACCACTCGG + Intergenic
1067929835 10:50549508-50549530 AGGAGGGGAACAACACATATTGG + Intronic
1068551343 10:58411268-58411290 AGGAGGGGAACATCACAAACTGG - Intergenic
1068851062 10:61741391-61741413 AGGAGGGCATCAACACAACTTGG + Intronic
1071974697 10:90943131-90943153 AGGAGGGGAACACCACACACTGG - Intergenic
1072115151 10:92363839-92363861 AAGAAGGGAACAACAGCACTGGG + Intergenic
1072380737 10:94867145-94867167 GGGTGGGGAACATCACCTCTGGG - Intergenic
1072387937 10:94951392-94951414 TGGAGGGGAACATCAACACCGGG + Intronic
1072517770 10:96202677-96202699 AGGAGGGGAACAGCACTCCCAGG + Intronic
1072728888 10:97831537-97831559 AGGGAGGGAACATCCCCACTGGG + Intergenic
1072879809 10:99215430-99215452 GGGAGGGAAACATCACCACCAGG + Intronic
1074156632 10:110805710-110805732 AAGAGGGAGGCACCACCACTAGG - Intronic
1076015782 10:127026635-127026657 AGAAGGGGACCAGCAACACTGGG - Intronic
1079442787 11:20532440-20532462 AGGAGGAGAAGATCACAACTAGG - Intergenic
1080687128 11:34524907-34524929 AGGCAGGGGACACCACCCCTGGG + Intergenic
1080814785 11:35744745-35744767 ATGGGGGGAACACCACAAATTGG - Intronic
1081221029 11:40461968-40461990 AGGAGGGGAACAGGAAGACTAGG + Intronic
1081798372 11:45838984-45839006 GGGAGGGGAACATCACAACTGGG + Intergenic
1084150798 11:67287077-67287099 CTGAGGGGAACCCCAGCACTAGG + Intergenic
1084674974 11:70629021-70629043 GGGAGGGAAACGCCAACACTTGG + Intronic
1086066082 11:82746507-82746529 TAGAGGGGAACAACACAACTGGG + Intergenic
1087668403 11:101077090-101077112 AGGATGGGAATACAAACACTAGG - Intronic
1088532060 11:110821154-110821176 AGATGGGGCTCACCACCACTGGG - Intergenic
1089430188 11:118417247-118417269 AGGAGGGGAACAACACCCAATGG + Intronic
1089754223 11:120674575-120674597 AGGATGGGAACAACACAGCTTGG - Intronic
1089796273 11:120983646-120983668 AGGAAGGGAACACCTGAACTAGG - Intronic
1090432042 11:126654189-126654211 TGGCGGGGAAGACCTCCACTGGG + Intronic
1093199368 12:16168623-16168645 ATGAGGGGAACAAAACCACTTGG - Intergenic
1097477099 12:60071837-60071859 AGGCAGTGATCACCACCACTAGG + Intergenic
1098106455 12:67072609-67072631 AGGAGGGGAACACCACACACCGG + Intergenic
1100446154 12:94661874-94661896 AGGAGGGGAACAACACAAGCAGG + Intergenic
1101969073 12:109300110-109300132 ATAATGGGACCACCACCACTGGG - Intronic
1104517883 12:129444634-129444656 GAGAGGGGAACAACACAACTGGG - Intronic
1105818799 13:24061686-24061708 AGGAGGGGAACAACAACACTGGG + Intronic
1107098397 13:36561060-36561082 TGGAGGGGAACAACCACACTAGG - Intergenic
1107277584 13:38693671-38693693 AGGAAAAGAACACCCCCACTGGG - Intronic
1107695449 13:42995013-42995035 AGGAAGGGAAAACCCACACTGGG + Intergenic
1109957260 13:69584602-69584624 AGGAAGGAACCACCACCACTAGG - Intergenic
1110283644 13:73724357-73724379 GGGAGGGGAACATCACACCTGGG + Intronic
1110414461 13:75236665-75236687 GGGAGGGGAACACACACACTGGG - Intergenic
1110861667 13:80350860-80350882 GGGAGGGGAACACCACACCGGGG - Intergenic
1111168631 13:84496246-84496268 GGGAGGGGAACATCACAACAGGG + Intergenic
1111812444 13:93107762-93107784 GGAAGGGGAACATCACAACTGGG - Intergenic
1114244301 14:20898545-20898567 GGAAGGGGAACATCACCACCGGG - Intergenic
1117591955 14:57279496-57279518 AAGCGGGGAACAACAACACTGGG + Intronic
1119855641 14:77898609-77898631 GGGAGGGGAACAACACACCTGGG + Intronic
1119907504 14:78319142-78319164 AGGAGGAGAACAGCACTCCTTGG + Intronic
1120349200 14:83330802-83330824 AGGAGGGGAACATCACACCCTGG - Intergenic
1120510549 14:85408498-85408520 AGAAGGGCAGCAGCACCACTTGG + Intergenic
1120936986 14:89906738-89906760 AGGAGGGGAACATTAGCAATGGG + Intronic
1123008296 14:105334923-105334945 TGGAGGGGAACCCCACCCCATGG - Intronic
1124083917 15:26528681-26528703 AGGGGGGGCACCCCACCACTTGG + Intergenic
1124170347 15:27367139-27367161 AGGATGGAAACTCCACCTCTGGG - Intronic
1125235348 15:37506406-37506428 AGGAGGGGAACACACACACCAGG - Intergenic
1125468859 15:39982722-39982744 AGGAGGGGAACATCACACATTGG - Intronic
1126890378 15:53198442-53198464 ACGATGAGAACACCACCATTTGG - Intergenic
1127222870 15:56898978-56899000 GGGAGGGGAACAACACGACTGGG + Intronic
1129160177 15:73743023-73743045 AGGAGAGGCCCACCACCTCTGGG + Intronic
1130368365 15:83261423-83261445 AGCAGTTCAACACCACCACTTGG - Intronic
1131260162 15:90883922-90883944 AGGATGGGGACAAAACCACTAGG + Intronic
1132418483 15:101642982-101643004 AGGAGGAGCTCACCACCACCTGG + Intronic
1133271073 16:4611062-4611084 AGCAGGGGATCCCCACCACCAGG - Intronic
1134417645 16:14058166-14058188 AGGAGTGCAAAATCACCACTGGG + Intergenic
1136189877 16:28609277-28609299 AGGAGGGGAGCATCTCCACTGGG - Intronic
1142083743 16:88165011-88165033 TGGAGGGGCACACCACCTGTGGG - Intergenic
1142645798 17:1313117-1313139 GGGAGGGGAACATTCCCACTGGG - Intergenic
1142645812 17:1313161-1313183 GGGAGGGGAACATTCCCACTGGG - Intergenic
1142645868 17:1313359-1313381 GGGAGGGGAACATTCCCACTGGG - Intergenic
1143118156 17:4592133-4592155 GGGAGGCAAACACCTCCACTGGG - Intronic
1143936751 17:10494087-10494109 AGGAGGAAAGCACCACAACTGGG - Intronic
1144740353 17:17578747-17578769 AGGAGGGGAACATCACACCGAGG + Intronic
1148623338 17:49050975-49050997 AGGAGGGGAACTCCACGCATGGG - Exonic
1148812830 17:50305161-50305183 AGGAGGGGAACCCCAAAACGTGG + Intergenic
1150189847 17:63226775-63226797 AGGAGGGGAACACCACCACTGGG - Intronic
1150876350 17:68975026-68975048 GGGAGGGGAACACCACACCCTGG - Exonic
1151688942 17:75668023-75668045 AGGAGGAGAACATCACCGTTAGG - Intronic
1152750045 17:82058476-82058498 AGCAGGGGAGCAGCCCCACTGGG + Intronic
1152950342 17:83226592-83226614 AGGAGGGAAACACCAACCCGAGG - Intergenic
1153345758 18:4024371-4024393 AGGAAGGGAGCACCACAGCTGGG + Intronic
1156466740 18:37352660-37352682 ATGAAGGGAACACCAGCTCTAGG - Intronic
1156965828 18:43090840-43090862 TGGAGGGGAATACCACCAGTGGG + Intronic
1158026671 18:52906192-52906214 CAGAGGGCAAGACCACCACTCGG - Exonic
1163321651 19:16578134-16578156 AGGATGGGAGTAACACCACTTGG + Intronic
1163325745 19:16602000-16602022 AGGCCGGGAAGCCCACCACTCGG + Intronic
1163526430 19:17824447-17824469 GGGAGGGGACCAGCATCACTGGG - Intergenic
1168165478 19:54544246-54544268 GGGAGGGGAACACATTCACTGGG - Intronic
927864321 2:26578998-26579020 AAGAGGGGGATACCACCACTGGG + Intronic
927997047 2:27494081-27494103 GGGAGGTGAACACCACCACCCGG - Exonic
928511247 2:32006080-32006102 AGGAGGGTAAAACCAAAACTGGG + Intronic
929022164 2:37564357-37564379 AGGACGGTAACATCACCCCTAGG + Intergenic
929950485 2:46406191-46406213 AGGCGGGGGACACATCCACTCGG + Intergenic
930234524 2:48876015-48876037 AGGAGGGTACCACGACCCCTGGG + Intergenic
931708446 2:64967440-64967462 AGGAGGGGAACAAAACCAAGTGG - Intergenic
935337976 2:102034698-102034720 AGGAGGGGCACACCACACCATGG + Intergenic
935371983 2:102356448-102356470 AGGAAGGGAAGACCACCATCCGG + Intronic
935612200 2:105037613-105037635 AGGAGGGGAAAACCCCTACTAGG + Intergenic
936181804 2:110273692-110273714 GGGAGGGGAACATCCACACTGGG - Intergenic
936230763 2:110697987-110698009 GGGAGGGGAACATCCACACTGGG + Intergenic
938463645 2:131513135-131513157 GGGAGGGGAAGACCTCCACATGG - Intergenic
939315988 2:140550029-140550051 AGGAGGGGAACATCACATATCGG - Intronic
939536126 2:143431466-143431488 AGGATATGAATACCACCACTTGG - Intronic
940260925 2:151779056-151779078 GGGAGGGGAACACCACACATGGG + Intergenic
940407531 2:153322674-153322696 GGGAGGAGAACATCACAACTAGG - Intergenic
941417011 2:165233363-165233385 AGGAGTAGAATACCACCACCAGG - Intergenic
941841269 2:170087297-170087319 AGGAGGGGAACAGGAACATTTGG + Intergenic
943038977 2:182781140-182781162 GGGAGGGGAACATCAACAATGGG - Exonic
943183338 2:184573525-184573547 GGGAGGGGAACATCACACCTTGG + Intergenic
943504989 2:188743830-188743852 GGGAGGGGAACATCACAACAGGG + Intronic
943777778 2:191785675-191785697 AGGAGGGGAACATCACACGTGGG - Intergenic
945617626 2:212092785-212092807 GGGAGGGGAACATCACAACCGGG + Intronic
945969470 2:216221747-216221769 AGGAGGGAAACACCAGGACACGG - Intergenic
945991518 2:216399508-216399530 AGGAGAGGAAAACCAAGACTTGG + Intergenic
946482907 2:220073929-220073951 AGGAGGAGCCCACCAGCACTGGG - Intergenic
948873546 2:240815831-240815853 AAAATGGGAACACCACCACCTGG + Intronic
1175348148 20:58297773-58297795 AGGAGGGACACAGCTCCACTTGG + Intergenic
1175536571 20:59718932-59718954 AGGAGGGGCTTGCCACCACTTGG - Intronic
1177720012 21:24893518-24893540 GGGAGGGGAACATCAACACCAGG - Intergenic
1177752155 21:25297893-25297915 AGGAGGGGAACACCACACACTGG + Intergenic
1178113271 21:29391537-29391559 AGGAGGGGAACAACACACATTGG - Intronic
1179467751 21:41589084-41589106 AGGGGGAGAACACCACCTCAAGG - Intergenic
1181040773 22:20191663-20191685 AGGAGGGGAAGGCCACCCATGGG + Intergenic
1183020936 22:35025150-35025172 GGGAGGGGAACATCACACCTGGG - Intergenic
1183831997 22:40423144-40423166 AGGAGGGGAACACCACTCAGTGG + Intronic
1184867413 22:47209391-47209413 AGGGGCTGAAGACCACCACTCGG - Intergenic
1184943994 22:47788136-47788158 AGGAGCTGAACTTCACCACTGGG + Intergenic
949620810 3:5809748-5809770 AGGAGTGGAACACAGCCTCTGGG + Intergenic
951071470 3:18333691-18333713 AGGATGTGAACACTACCACATGG + Intronic
951955674 3:28250620-28250642 AGAAGGGTAACATAACCACTAGG + Intronic
952082960 3:29782476-29782498 AGGAGGAGAACACCACATCAAGG + Intronic
952732556 3:36653868-36653890 AGGAGGAGAACACCACATCAAGG + Intergenic
953923417 3:46967541-46967563 AGGCTGGGAAGACCACCACCTGG - Intronic
958435087 3:94086398-94086420 AGGAGGAGAACACTTCCAGTGGG - Intronic
958943050 3:100335547-100335569 AGCAGGGAAACCCCGCCACTGGG - Intronic
961803357 3:129469990-129470012 AAGAGGGTAACATCACTACTTGG + Intronic
964131811 3:153297146-153297168 AGGAGGGGAACAGCACACGTGGG + Intergenic
967837273 3:193975125-193975147 TGGAAGGCAACACAACCACTCGG + Intergenic
970085557 4:12342229-12342251 AGGAGGCAAACTCCATCACTGGG + Intergenic
970729967 4:19091095-19091117 AGGAGGGGAAAACAGACACTGGG + Intergenic
971674784 4:29612247-29612269 AGGAGGGGAACATCACACCCCGG - Intergenic
972013527 4:34215055-34215077 AGCATGGGAACACTTCCACTGGG - Intergenic
974295026 4:59987087-59987109 GGAAGGGGAACATCACCACTGGG + Intergenic
974771095 4:66414539-66414561 AGGAGGGGAACATCACACATTGG + Intergenic
975365130 4:73520477-73520499 AGGAGGAGAACACCACATCAAGG - Intergenic
978517079 4:109580052-109580074 GGGCGGGGAACACCACACCTTGG - Intronic
979711042 4:123779529-123779551 GGGAGGGGAACATCACCCATCGG - Intergenic
980756725 4:137173846-137173868 GGGAGGGGAACACCACACATTGG + Intergenic
981290173 4:143065813-143065835 GGGAGGGGAACAACACACCTTGG - Intergenic
981442444 4:144798783-144798805 AGGAGGGGAACCCCACCTCAAGG - Intergenic
983453018 4:167930367-167930389 AGGAAGGGAACACCACCAATGGG + Intergenic
984324410 4:178233706-178233728 AGGAGGGGAACATCACACATCGG - Intergenic
984686853 4:182679029-182679051 GGGAGGGGAACATCACCCCAGGG + Intronic
986561470 5:9064612-9064634 AGGAGGGGAACACCACAGACCGG + Intronic
986769018 5:10955059-10955081 AGGAGGGGCACACCAAGTCTGGG + Intergenic
987290494 5:16504077-16504099 CGGAGGGGAACAACAATACTGGG - Intronic
991182374 5:63767583-63767605 GGGAGGGGAACATCACAACTGGG + Intergenic
993241717 5:85397713-85397735 AGGAGCGGAAACCCACAACTGGG + Intergenic
993346740 5:86793595-86793617 AGGAGGGGAACATCACGAACCGG - Intergenic
994394343 5:99215896-99215918 AGGTGGTGTACACCACCCCTGGG - Intergenic
1002744575 5:181460407-181460429 AGGAGGGAAACACCAACCCGAGG - Intergenic
1004387346 6:15184479-15184501 AGGAGGGGGAATCCACCACCAGG - Intergenic
1005171236 6:22987674-22987696 AGGAGGGGAACATCACACATGGG - Intergenic
1005182346 6:23120140-23120162 GGGAGGGGAACATCCACACTGGG - Intergenic
1005560602 6:27036317-27036339 AGGAGGGGAACATCACAACCGGG - Intergenic
1006243189 6:32705535-32705557 AGGAGGGGAACATCACAAACCGG + Intergenic
1006244370 6:32717502-32717524 AGCAGAGGAACACACCCACTGGG - Intergenic
1006815069 6:36844641-36844663 AGGAGGGGAAAAGCACCACCGGG + Intergenic
1009844193 6:69115413-69115435 AGGAGGGGAACAGCACACCCTGG + Intronic
1011085987 6:83541591-83541613 AGAAGGGGAACATCAACACCGGG - Intergenic
1012831083 6:104204280-104204302 GGGAGGGGAACACCACAAACTGG + Intergenic
1014186118 6:118436000-118436022 AGGAGGGGAACATCACACGTGGG + Intergenic
1017725250 6:157272566-157272588 AGGAGGGGAACACCAGCCCTGGG - Intergenic
1019055767 6:169222251-169222273 AGGTGGTGAACTCCACCACGGGG - Exonic
1020995534 7:15258870-15258892 AGGAGGAGAACACCACAACAAGG + Intronic
1022588182 7:31635743-31635765 GGGAGGGGAACACCACACATTGG + Intronic
1025888576 7:65623004-65623026 GGGAGGGGAACATCACAAGTGGG + Intergenic
1026411250 7:70125477-70125499 AGGCGAGGAAAACCACCACTGGG - Intronic
1026498648 7:70924343-70924365 AGGAGGGGACAACAGCCACTGGG - Intergenic
1027661840 7:80996915-80996937 GGGAGGGGAACATCACAACGGGG + Intergenic
1027823522 7:83079895-83079917 GGGAGGGGAACAACAACATTGGG - Intronic
1028039804 7:86037385-86037407 AGGAGGGGAACATCACCCACTGG - Intergenic
1028075336 7:86505816-86505838 TGGCGGGGAACAACAACACTGGG + Intergenic
1030106378 7:105990806-105990828 ACGAGGGGAACGCCACCTCCAGG - Intronic
1030429991 7:109433095-109433117 AGGAAGGAAACAAAACCACTAGG + Intergenic
1031289151 7:119910072-119910094 GAGAGAGGAACAACACCACTGGG - Intergenic
1031763316 7:125741880-125741902 AGCAAGGGAAAACCTCCACTGGG - Intergenic
1032114971 7:129109256-129109278 CGGAGGGGAACACCACACATTGG - Intergenic
1032680697 7:134179917-134179939 AGGAGAGGAACCCCAACCCTTGG + Intronic
1032890140 7:136185594-136185616 GGGAGGGGAACAACACCTGTTGG - Intergenic
1032919907 7:136534066-136534088 AGCAGGGGAAAAGCACCACCTGG - Intergenic
1033244671 7:139707893-139707915 AGGAGGGGAACGCCTGGACTGGG - Intronic
1034409658 7:150933439-150933461 AGGAGGGTAACAGAACCACTGGG + Intergenic
1034721638 7:153299377-153299399 AGGAGGGGAACCCAAGCAGTGGG + Intergenic
1036134855 8:6151518-6151540 AGGATGAGGATACCACCACTAGG + Intergenic
1036277147 8:7363948-7363970 AGGAGAGAAACACCATGACTCGG - Intronic
1038598492 8:28913149-28913171 AAGAGGGCAAGACCAGCACTAGG - Intronic
1038821012 8:30951736-30951758 AGGTGCGGACCACCACCACCTGG + Intergenic
1039370760 8:36981865-36981887 AGGAAGGAACCACCTCCACTGGG + Intergenic
1039821070 8:41136090-41136112 AGGAGGGGAACAACACACATGGG + Intergenic
1041944542 8:63426681-63426703 GGGAGGGGAACATCACACCTGGG + Intergenic
1042242817 8:66681831-66681853 AGGAGGTCAAGACCACCCCTGGG - Intronic
1043393324 8:79812265-79812287 AGGAGGGGAACAACACACATTGG + Intergenic
1044385279 8:91580816-91580838 AGGAGGGGAACATCACACCCTGG - Intergenic
1046362275 8:113176726-113176748 GGGAGGGGAACAACAACACTGGG + Intronic
1046395526 8:113633835-113633857 AGAAGGGGAGCAGCACCATTGGG - Intergenic
1048912468 8:139148986-139149008 AGGGTGGGAACAGCAGCACTTGG + Intergenic
1051914435 9:22191234-22191256 GGGAGAGGAACAACACAACTGGG - Intergenic
1056812057 9:89772537-89772559 AGGAGGGAATCACCACCAGGAGG - Intergenic
1059053689 9:110956205-110956227 GGGAGGGGAACACCACACATGGG + Intronic
1059785865 9:117583461-117583483 AGAAGGGGAAAACAAACACTGGG - Intergenic
1062139224 9:134946128-134946150 AGCAGGGGAAGCCCACTACTTGG + Intergenic
1062720229 9:138037720-138037742 AGGAAGTGTACACCACCACCTGG - Intronic
1203610384 Un_KI270748v1:90886-90908 AGGAGGGAAACACCAACCCGAGG - Intergenic
1186515813 X:10165430-10165452 AAGAGGGGAACACCACCCTCAGG - Intronic
1186909793 X:14150649-14150671 GGGAGGGGAACAACACACCTGGG - Intergenic
1189319607 X:40079789-40079811 AAGTGGGGAAGGCCACCACTAGG + Intronic
1189491568 X:41474736-41474758 AGGAGGCGGCCAACACCACTGGG + Exonic
1190058054 X:47193679-47193701 AGAAGTGGAACAGCACCACCTGG - Intronic
1191223177 X:58013695-58013717 AGGAGGAGAACACCACGTCAAGG - Intergenic
1193625511 X:83815466-83815488 GGGAGGGGAAAACCCACACTGGG - Intergenic
1193771629 X:85594056-85594078 AGGGGGAGAACACCACAACAAGG + Intergenic
1193775990 X:85642112-85642134 GGGAGGGGAACACCACCCACTGG - Intergenic
1194224893 X:91244602-91244624 AGTAGGGTAACACCATCAGTTGG + Intergenic
1194939998 X:99998096-99998118 AGAGGGGCAACAGCACCACTAGG - Intergenic
1195421370 X:104678792-104678814 GGGAGGGGAACATCACCCATGGG + Intronic
1196870166 X:120105813-120105835 TGGAGGGGAACACACTCACTAGG + Intergenic
1198816578 X:140598068-140598090 AGGAGGGGAACACCACACACTGG + Intergenic
1199226387 X:145379778-145379800 AAGAAGGGAACAACAACACTGGG - Intergenic
1200378246 X:155806983-155807005 AGGAGAGAAACACTACAACTGGG + Intergenic
1200893275 Y:8346327-8346349 GGGCGGGGAACATCACCACTGGG + Intergenic
1201441328 Y:14011917-14011939 AGGAGGGGAAGATCACCAACAGG - Intergenic
1201443243 Y:14030791-14030813 AGGAGGGGAAGATCACCAACAGG + Intergenic