ID: 1150192053

View in Genome Browser
Species Human (GRCh38)
Location 17:63253320-63253342
Sequence ATTAATAAGCAGAATGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4286
Summary {0: 3, 1: 61, 2: 801, 3: 1324, 4: 2097}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150192053_1150192058 24 Left 1150192053 17:63253320-63253342 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1150192058 17:63253367-63253389 CATATTTTCTCCCATTCTGTGGG 0: 34
1: 2580
2: 14290
3: 17857
4: 10086
1150192053_1150192057 23 Left 1150192053 17:63253320-63253342 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1150192057 17:63253366-63253388 ACATATTTTCTCCCATTCTGTGG 0: 14
1: 1186
2: 2537
3: 3546
4: 4647
1150192053_1150192054 -9 Left 1150192053 17:63253320-63253342 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1150192054 17:63253334-63253356 CTTATTAATCCCTTGACAGATGG 0: 2
1: 29
2: 594
3: 1016
4: 1000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150192053 Original CRISPR ATTAATAAGCAGAATGTATA AGG (reversed) Intronic
Too many off-targets to display for this crispr