ID: 1150192054

View in Genome Browser
Species Human (GRCh38)
Location 17:63253334-63253356
Sequence CTTATTAATCCCTTGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2641
Summary {0: 2, 1: 29, 2: 594, 3: 1016, 4: 1000}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150192053_1150192054 -9 Left 1150192053 17:63253320-63253342 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1150192054 17:63253334-63253356 CTTATTAATCCCTTGACAGATGG 0: 2
1: 29
2: 594
3: 1016
4: 1000
1150192052_1150192054 11 Left 1150192052 17:63253300-63253322 CCTATAGAGTTATTTGAGCTCCT 0: 16
1: 352
2: 713
3: 776
4: 726
Right 1150192054 17:63253334-63253356 CTTATTAATCCCTTGACAGATGG 0: 2
1: 29
2: 594
3: 1016
4: 1000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150192054 Original CRISPR CTTATTAATCCCTTGACAGA TGG Intronic
Too many off-targets to display for this crispr