ID: 1150192056

View in Genome Browser
Species Human (GRCh38)
Location 17:63253344-63253366
Sequence TGCAAACTATCCATCTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4409
Summary {0: 1, 1: 187, 2: 866, 3: 1491, 4: 1864}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150192056_1150192057 -1 Left 1150192056 17:63253344-63253366 CCTTGACAGATGGATAGTTTGCA 0: 1
1: 187
2: 866
3: 1491
4: 1864
Right 1150192057 17:63253366-63253388 ACATATTTTCTCCCATTCTGTGG 0: 14
1: 1186
2: 2537
3: 3546
4: 4647
1150192056_1150192058 0 Left 1150192056 17:63253344-63253366 CCTTGACAGATGGATAGTTTGCA 0: 1
1: 187
2: 866
3: 1491
4: 1864
Right 1150192058 17:63253367-63253389 CATATTTTCTCCCATTCTGTGGG 0: 34
1: 2580
2: 14290
3: 17857
4: 10086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150192056 Original CRISPR TGCAAACTATCCATCTGTCA AGG (reversed) Intronic
Too many off-targets to display for this crispr