ID: 1150192057

View in Genome Browser
Species Human (GRCh38)
Location 17:63253366-63253388
Sequence ACATATTTTCTCCCATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11930
Summary {0: 14, 1: 1186, 2: 2537, 3: 3546, 4: 4647}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150192053_1150192057 23 Left 1150192053 17:63253320-63253342 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1150192057 17:63253366-63253388 ACATATTTTCTCCCATTCTGTGG 0: 14
1: 1186
2: 2537
3: 3546
4: 4647
1150192055_1150192057 0 Left 1150192055 17:63253343-63253365 CCCTTGACAGATGGATAGTTTGC 0: 1
1: 252
2: 4533
3: 7742
4: 16718
Right 1150192057 17:63253366-63253388 ACATATTTTCTCCCATTCTGTGG 0: 14
1: 1186
2: 2537
3: 3546
4: 4647
1150192056_1150192057 -1 Left 1150192056 17:63253344-63253366 CCTTGACAGATGGATAGTTTGCA 0: 1
1: 187
2: 866
3: 1491
4: 1864
Right 1150192057 17:63253366-63253388 ACATATTTTCTCCCATTCTGTGG 0: 14
1: 1186
2: 2537
3: 3546
4: 4647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150192057 Original CRISPR ACATATTTTCTCCCATTCTG TGG Intronic
Too many off-targets to display for this crispr