ID: 1150192058

View in Genome Browser
Species Human (GRCh38)
Location 17:63253367-63253389
Sequence CATATTTTCTCCCATTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44847
Summary {0: 34, 1: 2580, 2: 14290, 3: 17857, 4: 10086}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150192056_1150192058 0 Left 1150192056 17:63253344-63253366 CCTTGACAGATGGATAGTTTGCA 0: 1
1: 187
2: 866
3: 1491
4: 1864
Right 1150192058 17:63253367-63253389 CATATTTTCTCCCATTCTGTGGG 0: 34
1: 2580
2: 14290
3: 17857
4: 10086
1150192053_1150192058 24 Left 1150192053 17:63253320-63253342 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1150192058 17:63253367-63253389 CATATTTTCTCCCATTCTGTGGG 0: 34
1: 2580
2: 14290
3: 17857
4: 10086
1150192055_1150192058 1 Left 1150192055 17:63253343-63253365 CCCTTGACAGATGGATAGTTTGC 0: 1
1: 252
2: 4533
3: 7742
4: 16718
Right 1150192058 17:63253367-63253389 CATATTTTCTCCCATTCTGTGGG 0: 34
1: 2580
2: 14290
3: 17857
4: 10086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150192058 Original CRISPR CATATTTTCTCCCATTCTGT GGG Intronic
Too many off-targets to display for this crispr