ID: 1150199041

View in Genome Browser
Species Human (GRCh38)
Location 17:63334356-63334378
Sequence GAAATCCTAGTGACTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150199041 Original CRISPR GAAATCCTAGTGACTAAAGC TGG Intronic
902053443 1:13581915-13581937 GAAAACCTAGAGAGAAAAGCTGG - Intergenic
905046305 1:35005351-35005373 GAAAACCTAGTTACTAAACAGGG - Intronic
905523753 1:38620859-38620881 GAATAGCTAGTAACTAAAGCAGG - Intergenic
907398401 1:54208635-54208657 GAAATCCAGGTGACTAGAGTAGG - Intronic
916831152 1:168492737-168492759 GAAATCCTAGTACCTAGAACAGG - Intergenic
917615618 1:176740939-176740961 ATGATCCTAGTGACAAAAGCTGG + Intronic
921185716 1:212667697-212667719 GAAATCCTACTGTCTGCAGCTGG + Intergenic
1064374847 10:14786169-14786191 GAATTCCCAGCGACCAAAGCTGG + Intergenic
1066493155 10:35914531-35914553 GAATTCCCAGTGGCCAAAGCTGG - Intergenic
1068078021 10:52282374-52282396 CTAATCCAAGTGACAAAAGCAGG - Intronic
1068593491 10:58875223-58875245 GAACTCCTAATGGCCAAAGCTGG + Intergenic
1068646071 10:59469989-59470011 GATATCCCAATGACAAAAGCTGG + Intergenic
1073497065 10:103901910-103901932 AAAATCCAAATGACTGAAGCTGG - Intronic
1077744038 11:4880597-4880619 TCAATGCTAGTTACTAAAGCAGG - Intronic
1077894713 11:6445288-6445310 GATATAGCAGTGACTAAAGCAGG - Intergenic
1078236434 11:9489278-9489300 CAAATGCTAGTGACTTCAGCTGG + Intronic
1079249059 11:18773870-18773892 GAAATCAGAGTGACTGGAGCAGG - Intronic
1079718162 11:23774715-23774737 GAAAGGCCAGTGATTAAAGCAGG + Intergenic
1080814065 11:35736929-35736951 TATATCATGGTGACTAAAGCAGG + Intronic
1083275259 11:61593501-61593523 GAAAACCAAGTGAGTACAGCAGG + Intergenic
1083286833 11:61665337-61665359 AGAATCCTAGTGACTGAGGCTGG + Intergenic
1086457047 11:86969288-86969310 GAAATCCTAGTTTCTAGAGAAGG - Intergenic
1086891374 11:92262178-92262200 GAAATTCTATTGACTAAATCAGG + Intergenic
1086974729 11:93118745-93118767 GCAATCCTAGTGCCTGAGGCAGG - Intergenic
1090087830 11:123666522-123666544 GAAATAATAGTGATTAATGCTGG + Intergenic
1094299528 12:28946605-28946627 CAATCCCTAGGGACTAAAGCGGG - Intergenic
1098632321 12:72739180-72739202 GAAATTGTAGAGAATAAAGCAGG - Intergenic
1108399896 13:50029982-50030004 AGAATGCTAGTGACTAATGCAGG - Intergenic
1110701038 13:78549353-78549375 GAACTCCCAATGACCAAAGCTGG + Intergenic
1113053936 13:106246753-106246775 GAAATCCTACTGAAAAGAGCAGG + Intergenic
1114449678 14:22817101-22817123 GAAGGCCTAGAGACTAAGGCAGG - Intronic
1115519524 14:34219559-34219581 GAAAGCCAAGAGACAAAAGCAGG + Intronic
1116349869 14:43847410-43847432 GAAGTCCTAGTGACAATAACTGG + Intergenic
1120698771 14:87674720-87674742 GAACTCCCAGTGGCCAAAGCTGG - Intergenic
1121837593 14:97106176-97106198 GAAATGCTAATGACAAAAGCAGG - Intergenic
1126861615 15:52889600-52889622 GAAATCCTAATAAATAAAGAGGG + Intergenic
1127322483 15:57860725-57860747 GAACTCCCAATGACCAAAGCTGG - Intergenic
1130612114 15:85370961-85370983 GCAATCCTAGGGACAAAAGCTGG + Intergenic
1138780895 16:59784404-59784426 GAACTCACAGTGACCAAAGCTGG - Intergenic
1142300758 16:89256716-89256738 GACATCCGAGTCACTGAAGCAGG - Intergenic
1143590495 17:7883611-7883633 GAAATCCTAGTGACTTTTGGGGG - Intronic
1148244907 17:46024307-46024329 CAAAGCCGAGTGACAAAAGCAGG - Exonic
1148715413 17:49712221-49712243 CAAAGCCAAGTGACTAAAGTGGG + Intronic
1150199041 17:63334356-63334378 GAAATCCTAGTGACTAAAGCTGG + Intronic
1150600774 17:66649134-66649156 AAATTCCTAGTAACTAATGCGGG - Intronic
1156830405 18:41484607-41484629 TAAATCCTAGTAAGAAAAGCAGG - Intergenic
1157167269 18:45369474-45369496 GAAATCCCAGGGACCAAAGATGG + Intronic
1157753158 18:50195585-50195607 GAAATCCTTGTCAGTAAAGTGGG + Intergenic
928001497 2:27526704-27526726 GAGCTCCTAGTGCCTAAAGTGGG + Intergenic
931207176 2:60159253-60159275 GAAATCATAGACACTAAAGGTGG + Intergenic
933682320 2:85113172-85113194 GAGTTCCTACTTACTAAAGCTGG + Intergenic
943473416 2:188324150-188324172 GACATCCTAATGTCTAAAGAAGG + Intronic
945385375 2:209192667-209192689 TAAATCCTAGTAATTAAAACTGG + Intergenic
947142873 2:227035776-227035798 TCAATCTTGGTGACTAAAGCTGG - Intronic
1169079994 20:2792270-2792292 GAAATCCTAGACAAAAAAGCAGG + Intergenic
1169808385 20:9582879-9582901 GAACTCCCAGTGACAAAAGCTGG - Intronic
1171304147 20:24090401-24090423 GAGATTCCAGTGGCTAAAGCTGG - Intergenic
1172851785 20:37971654-37971676 GAAGTCCTGGTGAATTAAGCAGG - Intergenic
1177306861 21:19329661-19329683 GGACTCCCAGTGACCAAAGCTGG - Intergenic
1177492935 21:21851773-21851795 GAAAACCTAATGAAAAAAGCTGG - Intergenic
1178603058 21:34011765-34011787 GAACTCCTACTGACCAAAGCAGG - Intergenic
1179298813 21:40088438-40088460 TAGATCCTAGTGACTAATGTGGG - Intronic
1182699455 22:32223595-32223617 GAAATCCTATTGACCCAAACAGG + Intronic
1183249722 22:36721669-36721691 GAAGTCCTATTGGCCAAAGCTGG + Intergenic
1183703152 22:39461189-39461211 GAATGCCTGGGGACTAAAGCTGG - Intronic
1185049935 22:48548702-48548724 AAAATCCCACTGGCTAAAGCAGG + Intronic
949239002 3:1847222-1847244 GAAATCCCAGTGGCCAAAGCTGG + Intergenic
951074088 3:18368105-18368127 AAAATACAAGTGACTACAGCAGG + Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
956136412 3:66103406-66103428 GCAATCCCAATGACCAAAGCTGG - Intergenic
957340739 3:78892965-78892987 GAAATCCAGGGGACTAAAGTGGG - Intronic
957730926 3:84135162-84135184 CATATCCTAGTGACTTAAGTTGG + Intergenic
958132867 3:89451793-89451815 CAAAGCTTAGTGACTAAAGCTGG + Intronic
960324130 3:116274289-116274311 TAAATCCCAGTGACAAAAGCAGG - Intronic
963139353 3:141934814-141934836 GTAATCCCAGCTACTAAAGCAGG - Intergenic
963255968 3:143145306-143145328 GGAATGCTAGTGACCAAAACGGG - Intergenic
963527623 3:146434064-146434086 GAAATCCTAGTTTCTAACACTGG + Intronic
964480662 3:157135277-157135299 GAAATGCTAGTGATTGAAGAAGG - Intergenic
964515613 3:157504580-157504602 GTGATCATAGTGACTAATGCAGG + Intronic
970072677 4:12179308-12179330 GAAACTCAAGTGACTTAAGCTGG + Intergenic
970388462 4:15581465-15581487 TAATTCCTAATGACTATAGCTGG + Intronic
973664913 4:53149353-53149375 GACTTCCCAGTGACCAAAGCTGG + Intronic
975735905 4:77380816-77380838 TAAAGCCTAGTAAGTAAAGCTGG + Intronic
979724807 4:123948102-123948124 GAAATCCTAATGTCTGAAGAAGG - Intergenic
985053585 4:186016858-186016880 GAAATCCTCTTCCCTAAAGCAGG - Intergenic
987257066 5:16166112-16166134 GAACCGCCAGTGACTAAAGCTGG - Intronic
987824875 5:23017975-23017997 GATATCTTAGTGATTAAAGTAGG + Intergenic
987876055 5:23682295-23682317 AAAAGCCAAGTGACTAAAGTAGG + Intergenic
995097035 5:108248949-108248971 GAAATCCAAATGATTAAAGAAGG + Intronic
995619156 5:114004227-114004249 GAGCTCCCAGTGACCAAAGCTGG + Intergenic
998987521 5:147777072-147777094 AAACTCCTAGTGACTCAAACAGG + Intronic
1000542394 5:162556114-162556136 AAAACCCTGGTGACCAAAGCTGG + Intergenic
1001151816 5:169236202-169236224 GAATTCTTAGTGGCCAAAGCTGG - Intronic
1007205409 6:40145951-40145973 GCCATCCTAGTGAATCAAGCAGG - Intergenic
1008712428 6:54244170-54244192 GAAATCCGTGTGAATAAACCAGG + Intronic
1010517220 6:76787814-76787836 GAGCTCCTAATGACCAAAGCTGG + Intergenic
1013130027 6:107223826-107223848 GAAATCCCAGAGTCTAGAGCAGG + Intronic
1015798844 6:137040590-137040612 GAACTCTTAGTGGCCAAAGCTGG + Intronic
1019203990 6:170343848-170343870 GACATACTAGTGAACAAAGCTGG - Intronic
1020578516 7:9964849-9964871 GACATCATAGTGACTCAGGCAGG - Intergenic
1023023864 7:36034178-36034200 GAAGTGGTAGTGACTAATGCTGG + Intergenic
1024320886 7:48067990-48068012 GAAATAGAAGTGACAAAAGCAGG - Intergenic
1030310156 7:108060656-108060678 GATCTTCTAGTGACCAAAGCTGG + Intronic
1030802795 7:113873796-113873818 GAGATCCTACTGACTGAAACAGG + Intergenic
1031421093 7:121552545-121552567 GGACTCCCAGTGACCAAAGCTGG - Intergenic
1033587211 7:142782946-142782968 AAAATGTTAGTGACTGAAGCCGG - Intergenic
1034472177 7:151261084-151261106 CAAATCCTTGTAACTAAGGCTGG + Intronic
1034878886 7:154748936-154748958 GAAAATCAAGTGAATAAAGCAGG + Intronic
1036092227 8:5679294-5679316 GAAATCCCAGAGAGTAATGCTGG - Intergenic
1038782976 8:30584139-30584161 GAAATCTTAGTGATTAGAGCTGG - Intronic
1042372915 8:68013137-68013159 GATATCCCAGTGAACAAAGCAGG + Intronic
1043301368 8:78738129-78738151 GAACTCCTAGTCAATAAAACAGG - Intronic
1043325688 8:79048065-79048087 AAATTCCTAATGTCTAAAGCTGG + Intergenic
1045611401 8:103847130-103847152 GAAATCCTGGTTCCTAAAGTGGG - Intronic
1046550073 8:115704967-115704989 GAAATCCTAATGATAAAAGAAGG - Intronic
1047054783 8:121151906-121151928 GAAATCATAGTGGCTTAAGATGG - Intergenic
1048548428 8:135408372-135408394 GAGCTCCCAGTGACCAAAGCTGG - Intergenic
1049131224 8:140844539-140844561 GAGTTCCCAGTGACAAAAGCTGG - Intronic
1050876555 9:10645523-10645545 GAAACCCCAGGGACTAAAGATGG + Intergenic
1051172092 9:14329082-14329104 GAAATCTAAGTGAGGAAAGCAGG - Intronic
1058952906 9:109920184-109920206 CACATCCTATTGGCTAAAGCAGG + Intronic
1060588059 9:124799191-124799213 CAAAGCCTAATGACCAAAGCTGG + Intronic
1186951919 X:14636008-14636030 GAGTTCCCAGTGACCAAAGCTGG + Intronic
1192835678 X:74796645-74796667 TAATTCCTAATGGCTAAAGCAGG + Intronic
1194053562 X:89102334-89102356 GAAACTATAGAGACTAAAGCAGG - Intergenic
1200484186 Y:3746977-3746999 GAAGTCCTGGTGACTCAAGCCGG - Intergenic