ID: 1150204503

View in Genome Browser
Species Human (GRCh38)
Location 17:63392069-63392091
Sequence TTCTATCAGAAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150204503_1150204507 27 Left 1150204503 17:63392069-63392091 CCTCTCTTCTTCTTCTGATAGAA 0: 1
1: 0
2: 4
3: 34
4: 383
Right 1150204507 17:63392119-63392141 TTCCGTCCTCATACTCGCCATGG 0: 1
1: 0
2: 0
3: 1
4: 36
1150204503_1150204504 -2 Left 1150204503 17:63392069-63392091 CCTCTCTTCTTCTTCTGATAGAA 0: 1
1: 0
2: 4
3: 34
4: 383
Right 1150204504 17:63392090-63392112 AACTGTTCACTGAGATCCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150204503 Original CRISPR TTCTATCAGAAGAAGAAGAG AGG (reversed) Intronic
900535253 1:3173839-3173861 TTCTCTCAGAGGAAGAACAAAGG - Intronic
902713062 1:18253730-18253752 TCCTGTCAGAGGAAGCAGAGAGG - Intronic
904069053 1:27778762-27778784 TACTAACAAAATAAGAAGAGTGG + Intronic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
904378871 1:30097871-30097893 CTCATACAGAAGAAGAAGAGAGG + Intergenic
904911504 1:33937614-33937636 TCCTCTCAGAGGAGGAAGAGAGG - Intronic
905188282 1:36212751-36212773 TGCTACCAGAAGAAGAGGAGTGG + Intergenic
906246400 1:44277644-44277666 GTGTTTCAGAAGAAGAGGAGTGG - Intronic
907227462 1:52961493-52961515 TTCTATCTGAAAACTAAGAGGGG - Exonic
908550219 1:65201325-65201347 TTCAATCAGAAGAAAAACACTGG - Intronic
909982903 1:82125588-82125610 TTTCATCAAAAGAAGAAGAAAGG + Intergenic
911787434 1:101968517-101968539 TTTTTTCAGAACAAAAAGAGAGG - Intronic
912368812 1:109156947-109156969 TTCTCTCAGAAGAAGGGGGGTGG + Intronic
913091921 1:115481986-115482008 TTTTATCAAAAGGAGAAGAGGGG - Intergenic
913289311 1:117257955-117257977 TACTATCAGAAGAACAGGATGGG + Intergenic
913533450 1:119749414-119749436 TTCATTCATCAGAAGAAGAGTGG - Intronic
913682623 1:121200998-121201020 TTAAACCAGAAGTAGAAGAGGGG - Intronic
914034466 1:143988627-143988649 TTAAACCAGAAGTAGAAGAGGGG - Intergenic
914154986 1:145079343-145079365 TTAAACCAGAAGTAGAAGAGGGG + Intronic
914756867 1:150567606-150567628 TTTTTACAGATGAAGAAGAGGGG + Intergenic
915196278 1:154192363-154192385 TTTTAAAAGAAGAGGAAGAGGGG + Intronic
915886529 1:159728311-159728333 TTCTATCACAAGAACAACAAGGG + Intergenic
916238634 1:162616056-162616078 ATCTATCAGAAAAAGAAGGGGGG - Intergenic
916275646 1:162990556-162990578 TTCTGTGAGAAAAAGAAGAAGGG + Intergenic
917510362 1:175664298-175664320 TCCTATCAGAAGGGGCAGAGTGG + Intronic
917693563 1:177494891-177494913 TTCTATCAGTAGAACATAAGAGG - Intergenic
917756027 1:178099431-178099453 TTCTCTCAAAAGAAGAAAAAAGG - Intronic
918432142 1:184472236-184472258 TTTAATCAGAAGAAGAAAGGGGG + Intronic
918454911 1:184700225-184700247 ACTTATCAGAAGAAGAAGACAGG + Intronic
920395328 1:205641268-205641290 TTCTAGGAGAGGAGGAAGAGAGG + Intergenic
920469935 1:206219516-206219538 TTAAACCAGAAGTAGAAGAGGGG - Intronic
920935897 1:210434124-210434146 ATTTATCAGAAGTTGAAGAGAGG + Intronic
921201165 1:212807827-212807849 TTCTATCATAAGAAGTGGACAGG + Exonic
921542048 1:216428357-216428379 TTCTAACAGAAGAAGCATAATGG - Intergenic
921594671 1:217041306-217041328 TTGTATCAGAAGAATGATAGGGG - Intronic
921985357 1:221306290-221306312 TTTTATCAGTAAAAAAAGAGTGG + Intergenic
922001675 1:221484957-221484979 TTCTACCAGTAGAAGAACAAAGG + Intergenic
922710911 1:227831134-227831156 TTATATTAGAAGAAGAAGAAAGG - Intronic
923772334 1:236948558-236948580 TTCTAGCAGATGGAGAAGAGAGG - Intergenic
923774920 1:236969597-236969619 TTTTATAAGAACAGGAAGAGAGG + Intergenic
924231894 1:241969298-241969320 TACTGGCAGAAGAAGAAGACTGG + Intergenic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
1063295519 10:4801386-4801408 TTCTATCAGATCATGAAGCGGGG + Intronic
1064140631 10:12787380-12787402 TTCTAACAGATGATGAAGACGGG + Intronic
1064820237 10:19321189-19321211 TTTTATCATGAGAAGAACAGAGG - Intronic
1065260317 10:23917042-23917064 TTCTATAAGAAGAAAAAAGGAGG - Intronic
1065804510 10:29382496-29382518 TGCTATAACAAGAAGAAGAAAGG + Intergenic
1065944625 10:30595244-30595266 TGCTATAACAAGAAGAAGAAAGG - Intergenic
1068400677 10:56523870-56523892 TTCTAACAGAAGGAGAAAATGGG - Intergenic
1069328754 10:67264685-67264707 ATCTATAATGAGAAGAAGAGAGG - Intronic
1071033898 10:81218767-81218789 TTATATCAAAAGTAGAAGGGAGG - Intergenic
1071224166 10:83508714-83508736 CTCTCTAAAAAGAAGAAGAGTGG + Intergenic
1071436645 10:85653742-85653764 TTTTATAAGGAGAAGAAGAGAGG + Intronic
1072746830 10:97946118-97946140 TTCTAGGAAAAGAAGAAGACAGG + Intronic
1073607605 10:104911999-104912021 TTTTATCAGAGGCAGAGGAGAGG - Intronic
1073904491 10:108262115-108262137 GTCTATCAGAAGATGGAGGGTGG - Intergenic
1074378527 10:112959270-112959292 TTCTCTAAGAAGAAAAAAAGGGG - Intronic
1074409293 10:113211255-113211277 TCCTATAAGAAAAAGAAAAGAGG - Intergenic
1074602834 10:114932648-114932670 TTCTCTCTGATGAAGAAGACAGG + Intergenic
1075198034 10:120378109-120378131 TTCCCGCAGAAAAAGAAGAGAGG - Intergenic
1075774370 10:124970690-124970712 CTCTTTGAGAAGAAGAAGAAGGG + Intronic
1075809276 10:125212885-125212907 TGCCATCAGGAGAAGGAGAGAGG + Intergenic
1079663979 11:23080648-23080670 TTCTATAAGAAGAGAAAGAGGGG - Intergenic
1079697841 11:23505857-23505879 TTCTATCAGAAGAAGAAGTCTGG + Intergenic
1079813250 11:25022734-25022756 TTCTATTAAAATAAGATGAGAGG + Intronic
1080032060 11:27672147-27672169 TTCTATCATAATAACAATAGTGG - Intronic
1081376994 11:42371383-42371405 TTCAATCAGAAGACATAGAGTGG - Intergenic
1081419501 11:42856895-42856917 TTCAGTCAGAAGAAAAGGAGAGG + Intergenic
1081458907 11:43252895-43252917 TTATATCAGAGGAAGAATGGTGG - Intergenic
1081711685 11:45220716-45220738 CTCTATCAAAAGAAGAAGGTTGG + Intronic
1086542219 11:87926630-87926652 TTCTAAATGAAGAGGAAGAGAGG + Intergenic
1087330914 11:96778727-96778749 TTCTAACAGAAAAAGCAGACAGG + Intergenic
1087510044 11:99080517-99080539 TCCTATCAGCAGAAGAGAAGGGG + Intronic
1088603977 11:111511858-111511880 TTGTATCAGAAATAGAAGGGAGG - Intronic
1089873954 11:121702090-121702112 TTATAGCAGAGGAAGGAGAGGGG + Intergenic
1093283958 12:17234381-17234403 TTCTGACAGATGGAGAAGAGAGG + Intergenic
1093507407 12:19884660-19884682 TGCTATCAGAAAAACAAAAGAGG - Intergenic
1093952449 12:25178996-25179018 TTATATTAGAAGAAGAAAAAAGG - Intronic
1094784582 12:33831891-33831913 TTCTATCAGAAGGGGGAGAGAGG + Intergenic
1095167108 12:38986855-38986877 TTCAATCAGAAGACAGAGAGTGG + Intergenic
1096305454 12:50470824-50470846 TTATATCTGAAGGGGAAGAGTGG - Intronic
1097745678 12:63300300-63300322 TTATATAAGAAAAAAAAGAGTGG - Intergenic
1098878248 12:75889553-75889575 TTCAATCAGCTGAGGAAGAGAGG + Intergenic
1099134711 12:78881708-78881730 TCCTTTCAAAAGAAGAAAAGAGG + Intronic
1099158372 12:79208531-79208553 TTCGATCAGAATGAGAAGAGAGG + Intronic
1099583883 12:84490594-84490616 GTCAATCAGAAAAAGAAAAGGGG + Intergenic
1100645992 12:96532107-96532129 TTCTCTCAGAAAAATAAAAGAGG - Intronic
1100959629 12:99947956-99947978 TGCTATTAGAAGAAGAAGTCAGG - Intronic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1103414710 12:120736539-120736561 TGCGATCAGAAGGAGAGGAGGGG + Intronic
1105585590 13:21739897-21739919 TGCTATCAGAACAACACGAGAGG - Intergenic
1106760364 13:32861779-32861801 TTCAATCAGGAGAATAAGTGGGG - Intergenic
1107664409 13:42674222-42674244 GTATATCAGAAGAAGATGAAGGG + Intergenic
1108434954 13:50392685-50392707 TTATATCAGCAGATGAATAGAGG + Intronic
1110062095 13:71055358-71055380 ATATATCACAAGAAAAAGAGAGG - Intergenic
1110672646 13:78199723-78199745 TTCTATCAGAGGATAAAGATGGG + Intergenic
1111835420 13:93382947-93382969 TTATATCAGAGGAATGAGAGAGG - Intronic
1112221455 13:97495371-97495393 TTCTAGCAGAAGAGGAAGTTTGG - Intergenic
1112432824 13:99367299-99367321 TTCAGTCATAAGAAGAAGAAAGG + Intronic
1112811772 13:103226351-103226373 CTCAATCACAAGAAGAAGAAGGG + Intergenic
1112905517 13:104415253-104415275 TTCCATGAGAAGAAGAAAATGGG - Intergenic
1113122435 13:106938361-106938383 TTGTATCAGAAGAGGAATTGTGG + Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1114194475 14:20465090-20465112 TGTTCTCATAAGAAGAAGAGAGG - Intergenic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1115610828 14:35046891-35046913 GTCTACCAGAGGAAGAAGAAAGG + Intronic
1116156909 14:41217273-41217295 TTCATTTACAAGAAGAAGAGTGG - Intergenic
1116664190 14:47754084-47754106 TTCTATCAGAAGAACAGCAAGGG + Intergenic
1117035021 14:51719808-51719830 TTCAAGCAGTATAAGAAGAGTGG - Intronic
1118038755 14:61895116-61895138 TTATATCAGAGGAAGAATAAAGG + Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1124960597 15:34390580-34390602 TGCTATCCAAAGAAGAAGAAAGG - Intronic
1124977226 15:34536801-34536823 TGCTATCCAAAGAAGAAGAAAGG - Intronic
1125127981 15:36247052-36247074 TAATATCAGAAAAAGATGAGGGG + Intergenic
1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG + Intergenic
1125692276 15:41605831-41605853 TTCTATTAGCAGAAGAAAATAGG + Intergenic
1125992733 15:44125665-44125687 TTATTTCTGAAGAAGAAAAGAGG + Intronic
1126274776 15:46864316-46864338 TTCTCCCAGAAGTAGGAGAGAGG - Intergenic
1127639762 15:60905152-60905174 ATCAATTAAAAGAAGAAGAGGGG - Intronic
1130129538 15:81127632-81127654 CTCTACCAAAAGAAGAGGAGGGG + Intronic
1131409195 15:92192091-92192113 TAGTATCAGAAGTAGATGAGTGG + Intergenic
1131940805 15:97562815-97562837 GACTATCAGAAGAAGAGAAGAGG - Intergenic
1135167983 16:20157291-20157313 TTCTATCAGAAGAAGTTCACCGG + Intergenic
1135507053 16:23048036-23048058 GTATATCAGAAAAATAAGAGAGG - Intergenic
1135883488 16:26282175-26282197 TTTTATCAGAATAGGATGAGAGG - Intergenic
1135912999 16:26578398-26578420 TTCTATCGGGAGAAGAGGATGGG - Intergenic
1136042341 16:27590132-27590154 TATTATCAGAAGGATAAGAGAGG - Intronic
1137516070 16:49145635-49145657 TTTTTTCAGAAGAGGAAGAAGGG + Intergenic
1137850894 16:51741409-51741431 TTTTATCAGAAGACGAAAAATGG + Intergenic
1140074476 16:71684596-71684618 TTCTATCTGAAGAAGAGGAGGGG + Exonic
1141002210 16:80318766-80318788 ATCTACCAAAAGAGGAAGAGGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141370811 16:83484660-83484682 TTAAATCTGGAGAAGAAGAGAGG - Intronic
1144171498 17:12663888-12663910 TTCAATGAGAAGAAGGAAAGTGG - Intergenic
1144901897 17:18601912-18601934 TTCTATGACAAGAATAAAAGGGG + Intergenic
1144929168 17:18844034-18844056 TTCTATGACAAGAATAAAAGGGG - Intronic
1144933138 17:18876328-18876350 TTCTATGGGAAGGATAAGAGTGG - Intronic
1145130603 17:20344157-20344179 TTCTATAACAAGAATAAAAGGGG - Intergenic
1146303059 17:31706294-31706316 TTCTTGAAGAAGAACAAGAGGGG + Intergenic
1148330265 17:46809878-46809900 TTCCAGCAGAGGAAGAAGTGGGG - Intronic
1150204503 17:63392069-63392091 TTCTATCAGAAGAAGAAGAGAGG - Intronic
1153143714 18:2003799-2003821 TTATCTTAGAAAAAGAAGAGAGG + Intergenic
1153505478 18:5792657-5792679 GCCTATCAGAGGATGAAGAGTGG + Intergenic
1156758651 18:40559518-40559540 TTCTAGAGGAGGAAGAAGAGGGG + Intergenic
1160318936 18:77872368-77872390 TTCAATAAGAAGGAGAGGAGTGG + Intergenic
1166323772 19:42036668-42036690 TTCTATCAGATGAAGAGAACTGG + Intronic
1167746014 19:51352251-51352273 TTCTATGAGCAGAAGAGGGGTGG - Intronic
1168137780 19:54362986-54363008 TTCTATCTGAAGATAAACAGGGG + Intronic
1168160241 19:54505639-54505661 TTCTATCTGAAGATAAACAGGGG - Intronic
1168463332 19:56580735-56580757 TTCTATCAGCAGAAGTGAAGAGG - Exonic
925213657 2:2073313-2073335 TTCTCTCACTAGAAGAAGAAGGG + Intronic
925866109 2:8227494-8227516 TTCCAGCAGGAGAAGAAGACTGG - Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926154350 2:10444262-10444284 TTCAGTCTGAAAAAGAAGAGTGG + Exonic
926816253 2:16800715-16800737 TTCTATTAGGAGCAAAAGAGTGG - Intergenic
928381428 2:30821844-30821866 TTGTATCTGAAGGAGAGGAGAGG - Intergenic
931679279 2:64730116-64730138 CTCTCTCAGAAGCAGAGGAGTGG + Intronic
934565657 2:95339172-95339194 TTGTAGAAGAGGAAGAAGAGAGG - Intronic
935728073 2:106041152-106041174 TTATAGCAGAAATAGAAGAGAGG - Intergenic
936286483 2:111185315-111185337 TACTAACAGAAAAAGAAAAGGGG - Intergenic
936496855 2:113029930-113029952 TTCTAATAGAAGGAGAAGATGGG + Intronic
936799276 2:116246992-116247014 TACTATCAGGAAAAGAATAGAGG - Intergenic
936803253 2:116292411-116292433 TTCCATCAAAAGAAACAGAGTGG - Intergenic
938864727 2:135406428-135406450 TTCCATCAATAGAAAAAGAGGGG + Intronic
939565765 2:143784883-143784905 TTTTATCAGGAGAGGAAGAAAGG + Intergenic
940135753 2:150434569-150434591 TTATATCAGAAGATTAAGAGTGG - Intergenic
940314138 2:152309666-152309688 TTCTTTCACAGGAAGAAAAGAGG - Intergenic
940450095 2:153826242-153826264 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
942121367 2:172781312-172781334 TTCAGTCAGAAGAATAAGACAGG + Intronic
942566534 2:177269688-177269710 TTTTATAAGAAGAAGAAAAAAGG + Intronic
943115157 2:183659950-183659972 TTCTAGCAGCAGTATAAGAGAGG - Intergenic
943518269 2:188913621-188913643 TTCAATCAGAAGACATAGAGTGG + Intergenic
943538545 2:189182943-189182965 TACTAGCAGAAGAAGAAAGGTGG - Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
945396067 2:209319997-209320019 TTTAATCAGAATGAGAAGAGAGG + Intergenic
946159920 2:217829869-217829891 TTCCCTCAGAGGAAGATGAGGGG - Exonic
946555224 2:220849057-220849079 TACTATCAGGAGAAGAGCAGGGG + Intergenic
946626412 2:221616484-221616506 TTCTCTCAGTAAAAGAAGATGGG - Intergenic
947210853 2:227707265-227707287 TTCTACCAGCAAAAGAAGAAAGG - Intronic
948790972 2:240376692-240376714 TCCTATCAGGAGACGAAGATGGG + Intergenic
1168845938 20:944753-944775 TTCCATCAGTAGGAGAAGACAGG + Intergenic
1169235660 20:3927995-3928017 GGATATCAGAAGAAAAAGAGGGG - Intronic
1169659799 20:7965614-7965636 TTCAATTAGAAGAAAAAGAGAGG + Intergenic
1169988967 20:11477723-11477745 TTCAATCAAAAGAAGTAGGGTGG + Intergenic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170242449 20:14183179-14183201 GCCTATCAGAAGGAGGAGAGTGG - Intronic
1171266284 20:23774570-23774592 TTTTATCAGTAGGAGATGAGAGG + Intergenic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1172563978 20:35913829-35913851 TCTTATCAGAAAAAGAGGAGAGG + Intronic
1173240792 20:41295160-41295182 TTCTTCCAGAAGAACAAAAGAGG + Intronic
1174715398 20:52752330-52752352 TTTTATCAAAAGAAGAAAAAAGG + Intergenic
1174970808 20:55273584-55273606 TTTAGTCTGAAGAAGAAGAGAGG - Intergenic
1177252214 21:18608297-18608319 TTCTAAGGGAAGAGGAAGAGTGG - Intergenic
1177522213 21:22240011-22240033 CGCTATCAAAAGAAGAAGATGGG - Intergenic
1177599755 21:23295412-23295434 TCCAAGCAGAAGAAGATGAGGGG - Intergenic
1177854077 21:26382417-26382439 TACTATCACAAGAATAAGACGGG - Intergenic
1178138530 21:29655681-29655703 TTCCATGAGAAGGGGAAGAGAGG + Intronic
1178635628 21:34299809-34299831 TTATCTCAGAAGAAGGAAAGAGG + Intergenic
1179154287 21:38836462-38836484 TTCTGTCAGAAGAAGATTATCGG + Intergenic
1180669034 22:17538573-17538595 TTCTATCACAAACAGAACAGTGG - Intronic
1182193644 22:28491134-28491156 TTCGGTAAGAAGAGGAAGAGAGG - Intronic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1183136810 22:35896781-35896803 TGCCTTCAGAAGAAGCAGAGAGG - Intronic
1184580740 22:45415323-45415345 TATGCTCAGAAGAAGAAGAGAGG + Intronic
949243887 3:1902703-1902725 TCCTATCAGGAGATGAACAGAGG - Intergenic
949771654 3:7585954-7585976 TTCTAGGACCAGAAGAAGAGAGG - Intronic
950905084 3:16530691-16530713 TTCCACCAGAGGATGAAGAGTGG + Intergenic
951115948 3:18861951-18861973 TTCTATTATAAGAAGAAAGGGGG + Intergenic
952053322 3:29413058-29413080 TTCTCACATAAGAAAAAGAGAGG + Intronic
953021614 3:39117949-39117971 TTCTATTATTAAAAGAAGAGGGG + Intronic
954301536 3:49703153-49703175 TTCACTCAGGAGAAGCAGAGAGG - Intronic
954635462 3:52068577-52068599 TTCTGTCTGAAGGAGAGGAGTGG - Intergenic
954854935 3:53635807-53635829 GACTATCTGGAGAAGAAGAGAGG - Intronic
955676102 3:61450443-61450465 TGCTATAAGGAGAAGTAGAGTGG - Intergenic
957232739 3:77541120-77541142 TTATATCCAAAGAAAAAGAGTGG + Intronic
958852294 3:99343235-99343257 ATGTAGCAGAAAAAGAAGAGAGG - Intergenic
960265872 3:115620414-115620436 TTCTAGAAAAAGATGAAGAGTGG - Intergenic
960372904 3:116862837-116862859 TTCTACCACAAGAGGATGAGTGG + Intronic
960384755 3:117009299-117009321 TTCTCTTAGAAGAAAAAGAAAGG - Intronic
960408476 3:117291868-117291890 TTCCTTAAGAAAAAGAAGAGTGG - Intergenic
960654226 3:119984796-119984818 TTCAATCAATAGAAAAAGAGGGG + Intronic
961321423 3:126078976-126078998 TTGCATCAGGAGAAGAGGAGGGG - Intronic
962809058 3:138946433-138946455 TTCTACGAGAAGAATAAGAAGGG - Exonic
963675272 3:148302915-148302937 TGCTATTAGAATAAGAAGACTGG - Intergenic
964089064 3:152851324-152851346 CTCTAGCAGAAAAAAAAGAGAGG - Intergenic
964880824 3:161420783-161420805 TTCTAACAGAAGAGGGAGAAAGG - Intergenic
965010384 3:163080507-163080529 TTCAAACAAAAGAAAAAGAGGGG + Intergenic
965538281 3:169847621-169847643 CTCTATTAGAAAAAGATGAGAGG - Intronic
966593713 3:181708151-181708173 TTCCATAAGAAGATTAAGAGAGG + Intergenic
967016917 3:185490744-185490766 GACTAACAGAAGATGAAGAGCGG + Exonic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
968044264 3:195614972-195614994 TCCCAGCAGAAGAAGAAAAGGGG - Intergenic
968060052 3:195721035-195721057 TCCCAGCAGAAGAAGAAAAGGGG - Exonic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
970066275 4:12097330-12097352 TTCTAAAAGAAGCAGAAAAGGGG + Intergenic
970148484 4:13064008-13064030 TCCAATCAAAAGAAGCAGAGTGG - Intergenic
970705405 4:18795573-18795595 TTTTATAAGGAGAAGAAGAGAGG - Intergenic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
971567601 4:28165621-28165643 TTCTATCAAAAGACATAGAGTGG - Intergenic
971813253 4:31455418-31455440 TGCTATCTGGAGAAGAAGAGAGG + Intergenic
971862194 4:32122243-32122265 TTCCATGAGAAGAAAGAGAGAGG - Intergenic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
974193867 4:58543426-58543448 TTCTACCTGAAGAATAATAGAGG - Intergenic
974386217 4:61203193-61203215 TTCTATCAGAGGTAGGAAAGTGG - Intronic
974608259 4:64181825-64181847 TTCTGTCAAAAGCATAAGAGAGG + Intergenic
974737535 4:65956986-65957008 TTTTATAAGAAGATGAAAAGTGG - Intergenic
974810363 4:66937962-66937984 TTCTATAAGATAAAAAAGAGAGG + Intergenic
975069007 4:70108950-70108972 TTATACCAGAAGAGGAAGAGAGG - Intergenic
975098055 4:70480487-70480509 TTCCACCAGAGGAAGAAGAGAGG + Intronic
975546327 4:75564056-75564078 TGGTAACAGAAGCAGAAGAGTGG - Intronic
975594049 4:76030457-76030479 TACTATCATAAAAAGAAGAAGGG - Intronic
976797467 4:88950710-88950732 TTATTCCAGATGAAGAAGAGTGG + Intronic
977161168 4:93637740-93637762 TTGTAGCAAAAGAAGATGAGAGG - Intronic
977429715 4:96915966-96915988 TGGTATCAGGAGATGAAGAGAGG + Intergenic
978520072 4:109606306-109606328 TTCAATCAGAAGACAGAGAGTGG - Intronic
978907632 4:114026568-114026590 TCCTATCAGAAGAAAATGAAAGG - Intergenic
979149934 4:117298653-117298675 TTCTATCAGAATAAGCAGGTGGG - Intergenic
979399703 4:120233472-120233494 CTCTATCAGAAGAAGAGCAAGGG + Intergenic
979944502 4:126811949-126811971 TTAAATTAGAATAAGAAGAGTGG + Intergenic
980268696 4:130554854-130554876 TTCAATCAAAAGACGTAGAGTGG + Intergenic
980620227 4:135291608-135291630 TTCTATCAGAAAGAAAAGACAGG - Intergenic
980846612 4:138332555-138332577 TACTATCAGAAGAAGAGCACGGG + Intergenic
981446390 4:144843434-144843456 TTCAATCAGAAGCTGTAGAGTGG + Intergenic
982710123 4:158749561-158749583 TCCAATCACAAGAAGAAGGGAGG + Intergenic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
984331618 4:178327909-178327931 ATTTATGAGAAGAAGAAGATTGG + Intergenic
985215016 4:187642640-187642662 TTCAATCAGAAGACATAGAGTGG + Intergenic
987418940 5:17695286-17695308 TTCTATCACAAGTAACAGAGTGG - Intergenic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
989722224 5:44542827-44542849 TTCTTTCAGAAGAAGATTATGGG + Intergenic
989736890 5:44718353-44718375 GTCTATCAGAAGAAGAATGTGGG - Intergenic
990630173 5:57660081-57660103 TTCTTACAGAAGGAGAAGTGAGG + Intergenic
991192476 5:63890653-63890675 TTCTATGAGAAACAGTAGAGAGG - Intergenic
992850146 5:80798715-80798737 TTGTTTCAGAAGCAGGAGAGAGG - Intronic
992850907 5:80806663-80806685 TTCTATTAGGAGAATAGGAGGGG - Intronic
993113138 5:83684406-83684428 TACTATTGGAAAAAGAAGAGGGG + Intronic
993204533 5:84863058-84863080 GTTTATCAGAAGAATGAGAGTGG + Intergenic
993291099 5:86071675-86071697 TTCTATCAGCTGAAGAAGTGAGG + Intergenic
993473741 5:88338468-88338490 TCCTATCAGAAGACATAGAGTGG + Intergenic
994513035 5:100732043-100732065 TTTTAGCAGAAATAGAAGAGAGG - Intergenic
994588413 5:101741812-101741834 TTCTATCAGGAGAAGAGCAAGGG + Intergenic
995037047 5:107546007-107546029 TGCAATCAGAAGAGGAAGAGTGG + Intronic
995933771 5:117483960-117483982 TTCTAGCAGAAGAAACAAAGGGG - Intergenic
996201276 5:120677469-120677491 TTCTAACAAGAGAAGAAGACCGG - Intronic
996306888 5:122057328-122057350 TACTATCAGAAGAAAAGGAAAGG + Intronic
996402457 5:123076932-123076954 TACTATCAGTAGAAGTATAGTGG - Intergenic
996569707 5:124919281-124919303 TTCTACCAGAATGAGAAGTGTGG - Intergenic
996836412 5:127798400-127798422 TGCTATCAGAAGAAGAGAACTGG + Intergenic
998279743 5:140794973-140794995 TTCTATCAGAAGGGGCCGAGGGG + Exonic
998538529 5:142956893-142956915 TACTATCATAAGAATAAGATGGG + Intronic
1000325051 5:160165696-160165718 TGCTAACAGAAGGAGCAGAGTGG - Intergenic
1000631924 5:163600502-163600524 TTCTAGAAGAGGAAAAAGAGTGG - Intergenic
1000659309 5:163918833-163918855 CTCTATTAAAAGAAAAAGAGAGG - Intergenic
1001235190 5:170023208-170023230 TTCTCTCAGAGAAAGAAGAGGGG + Intronic
1001426537 5:171626162-171626184 TTTTCTAAGAAGAAGAAGAAAGG - Intergenic
1001806334 5:174589939-174589961 TCCTATCAGAGGCAGAAGAGAGG - Intergenic
1002451353 5:179320617-179320639 TGCTATCAGAAGGAGAAGGGTGG - Intronic
1002560914 5:180081445-180081467 TTCTTTCAGAAGTAGAGGTGGGG + Intergenic
1002964316 6:1947460-1947482 TTGTATCAGAGGAATAAGGGAGG - Intronic
1003236503 6:4300017-4300039 TGCAAGCAGAAGAGGAAGAGAGG - Intergenic
1003744020 6:8979378-8979400 TTCTAACTGAAGAACAAAAGAGG - Intergenic
1003943497 6:11051633-11051655 TTCTAGCAGAAGAGGATGTGTGG - Intergenic
1004256063 6:14065685-14065707 TTTTATCTGAAGGAGTAGAGAGG - Intergenic
1004581151 6:16954206-16954228 TTCAAGCACAAGAAGAAAAGGGG - Intergenic
1005015229 6:21369189-21369211 TTCAAGTAAAAGAAGAAGAGAGG + Intergenic
1005017107 6:21384917-21384939 TTATTTCAGTAGAAGAAGATGGG - Intergenic
1006768458 6:36530278-36530300 TTCTGTCAGGAAGAGAAGAGGGG + Intronic
1007097798 6:39224836-39224858 TCCTAACAGAAGATGGAGAGTGG - Intronic
1008151547 6:47958034-47958056 TTCTATCAGTAGCTAAAGAGTGG - Intronic
1008228541 6:48954491-48954513 TTCTATTAGAAGGAAAAGATTGG - Intergenic
1008700981 6:54099038-54099060 TTATATCAGAAGAATAAATGTGG - Intronic
1008847934 6:55991235-55991257 TCCCATCAAAAGAAAAAGAGTGG - Intergenic
1008881234 6:56382611-56382633 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1010068953 6:71720578-71720600 TTCCATCAGAAGAAAAACACTGG + Intergenic
1010312217 6:74400766-74400788 TCCAATCAGTAGAAAAAGAGGGG + Intergenic
1010384827 6:75267964-75267986 TTCTTTGATAAAAAGAAGAGAGG - Intronic
1010797384 6:80133315-80133337 TGCTATAAGAAAAGGAAGAGAGG + Intronic
1011436575 6:87344446-87344468 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1012470123 6:99562867-99562889 TTCTCTCAGAGGAAGAATATTGG - Exonic
1013600255 6:111697399-111697421 TTCTATTTGAAAAAGAAGACTGG + Intronic
1013866682 6:114706666-114706688 TTTTCCCAGAAGAAAAAGAGAGG - Intergenic
1014142677 6:117962639-117962661 GTCTATCAGTAGGAGAGGAGTGG - Intronic
1016218999 6:141643049-141643071 TTCTCTCAAAAGATAAAGAGAGG + Intergenic
1016246657 6:141989777-141989799 TTCCATCAGAATGAGGAGAGAGG - Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1018404999 6:163470916-163470938 TAGTATTAGAAGAAGAGGAGAGG + Intronic
1018646121 6:165950414-165950436 TTCTATCAAAAGAATGAGAGAGG + Intronic
1020605933 7:10336946-10336968 TTCTACCAGCAGAAGAAAACTGG + Intergenic
1020699250 7:11457822-11457844 TAATATTAGAAGAAGTAGAGAGG - Intronic
1020830652 7:13090618-13090640 TTTTATCAAAAGATGAAGACAGG - Intergenic
1021214161 7:17895502-17895524 TTTTATTAGAAAAACAAGAGAGG + Intronic
1021248047 7:18288998-18289020 TTCTAGAAGAAAAAGAAGAGGGG - Intronic
1021549743 7:21857847-21857869 TTCTAGGAGAAAAATAAGAGAGG + Intronic
1022452810 7:30531380-30531402 TGCTATCTAAAGAAGAAGAAAGG - Intronic
1023301327 7:38775317-38775339 TTTTTCCAGAAGAAGAAGCGAGG - Intronic
1024115545 7:46189615-46189637 TCCTATCAGAAGAAGGTGAAGGG + Intergenic
1024752695 7:52487018-52487040 TTCAGTGAGAAGAAGAAAAGAGG - Intergenic
1026216146 7:68350876-68350898 TTGGATCAGTAGAAGGAGAGAGG + Intergenic
1028270483 7:88782264-88782286 CTCTATCAGAAGGAGATCAGAGG + Intronic
1028416403 7:90585037-90585059 TTCAACCAGAACAAGAAAAGGGG - Intronic
1028952603 7:96653825-96653847 CTCTTTCAGAAGAAAAAGAGAGG - Intronic
1029680983 7:102109481-102109503 ATCTATCAAAACAAGAAAAGTGG + Intronic
1030457310 7:109792016-109792038 TTCTATCAAAAAAAGGACAGAGG - Intergenic
1030561669 7:111094697-111094719 CTTTATCAGAAGGAGAGGAGAGG - Intronic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1033006311 7:137568309-137568331 TTTTACCAGGAGAAGAAGAATGG - Intronic
1033074518 7:138235986-138236008 TTCTATTAATGGAAGAAGAGTGG + Intergenic
1033756693 7:144402455-144402477 TTCTAACAGATGAAGAAATGAGG + Intronic
1034074944 7:148222419-148222441 GTCTATAAGAAGAGGAAGAGAGG - Intronic
1034812107 7:154141610-154141632 TTCTAACAGAAGCAGAAGAAAGG - Intronic
1035106074 7:156442294-156442316 TTGTATCATAAGAAAAAAAGGGG - Intergenic
1035979352 8:4352073-4352095 TTCCAGCAGTAGAAGGAGAGTGG - Intronic
1037103525 8:15077528-15077550 TTCTAACTGAAGGAGAAGAAGGG + Intronic
1037698390 8:21248750-21248772 TTCTTTCAGAAGAAAAAAAAGGG - Intergenic
1038741185 8:30218471-30218493 TACTATCAGGAGAAGAATATGGG - Intergenic
1039822757 8:41148178-41148200 TTCTAGAAGAAGAAGAAGAGAGG + Intergenic
1041497265 8:58500258-58500280 TTCTATTAGAAAAAAAAAAGTGG + Intergenic
1041735858 8:61109791-61109813 TTTTATAAGAAGAGGAGGAGAGG + Intronic
1042414865 8:68507826-68507848 TTTTCACATAAGAAGAAGAGAGG - Intronic
1043104600 8:76091329-76091351 TCCTAGAAAAAGAAGAAGAGAGG + Intergenic
1043316881 8:78933444-78933466 ATATTTTAGAAGAAGAAGAGTGG - Intergenic
1043844249 8:85146275-85146297 TCCTTTCAGAAATAGAAGAGGGG - Intergenic
1044518887 8:93174855-93174877 TTCTTTTAGAAGAAAAATAGAGG - Intergenic
1044755729 8:95459149-95459171 ATCTATGAGAAAAGGAAGAGGGG + Intergenic
1045792759 8:106004346-106004368 AGCTATCAGAAGAAGATGAGGGG + Intergenic
1046306148 8:112369929-112369951 TGCAAGAAGAAGAAGAAGAGGGG + Intronic
1047148989 8:122239912-122239934 TTCTTACAGAAAAAGAAAAGTGG + Intergenic
1047508589 8:125498899-125498921 TCCCATCAAAAGAAGAAAAGAGG - Intergenic
1047933864 8:129756034-129756056 ATCAATCAAAAGATGAAGAGTGG + Intronic
1047959707 8:130002158-130002180 TTCTTAGAGAAGAAGAAAAGAGG + Intronic
1048052628 8:130832776-130832798 TTCTCTCATAAGAAGGAGAGAGG + Intronic
1048213570 8:132476964-132476986 TTCTATCAGGAGAAGAGCAAGGG - Intronic
1048687538 8:136920510-136920532 TTATGTCAGAAGGTGAAGAGGGG + Intergenic
1048913730 8:139162039-139162061 TTCTACCAGAGGTAAAAGAGGGG - Intergenic
1050214582 9:3308364-3308386 TATTTTCAGAAGATGAAGAGGGG + Intronic
1050258617 9:3817916-3817938 ATCCATAAGGAGAAGAAGAGTGG + Intergenic
1051474183 9:17485291-17485313 ATCTTTCAGAAGCTGAAGAGGGG - Intronic
1052111093 9:24582852-24582874 ATCTATCAAAAACAGAAGAGAGG + Intergenic
1052125499 9:24769751-24769773 TTCTATCTGAAGATGGGGAGAGG + Intergenic
1055122708 9:72680965-72680987 TTCTAACTCAAGAAGAAGAATGG - Intronic
1055157607 9:73083291-73083313 TACTATCACAAGAAGAGCAGGGG + Intergenic
1055749628 9:79490495-79490517 TTCTATTATATGAAGAAAAGAGG - Intergenic
1055821009 9:80264003-80264025 TTCTACCACAAAAAGAAGAAAGG + Intergenic
1056013640 9:82358688-82358710 TTCCATCAGAGGAGGAAGGGGGG - Intergenic
1056248606 9:84724603-84724625 TTCTATCAGAAAAAAGACAGAGG - Intronic
1056305308 9:85285096-85285118 TTACATCTGAATAAGAAGAGTGG + Intergenic
1056849627 9:90071457-90071479 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
1058958352 9:109969819-109969841 TTCTCCCAGAAGCAGTAGAGGGG - Intronic
1059722653 9:116976187-116976209 GTCTATGGGAAGAAGGAGAGGGG + Exonic
1060033839 9:120237962-120237984 TTTTCTTATAAGAAGAAGAGAGG - Intergenic
1061151874 9:128833409-128833431 TTCTCTAAGATGAAGAAGGGCGG + Exonic
1062491337 9:136806536-136806558 TGCTAAAAGAGGAAGAAGAGAGG + Exonic
1185646016 X:1616293-1616315 TTCTGTGAGAAGAAGAAATGAGG - Intronic
1186537900 X:10368694-10368716 TTCTCTCAGTAAATGAAGAGAGG - Intergenic
1186539609 X:10387166-10387188 TTTTATCAGGAGAGCAAGAGTGG - Intergenic
1187352259 X:18531114-18531136 ATCTAACAGAAGAAAAGGAGGGG - Intronic
1187811590 X:23184418-23184440 TTATATTAGAAAAAGAAGAAAGG - Intergenic
1187858719 X:23661417-23661439 AACTCTTAGAAGAAGAAGAGAGG + Intergenic
1188004790 X:25009920-25009942 TTCAATCAGGAGAAGTAGATCGG + Intronic
1188398473 X:29715666-29715688 TACTTTCAGGAGAAGGAGAGTGG - Intronic
1188532881 X:31162027-31162049 TTCTATCAGAGGGAGTAGAGAGG - Intronic
1188577552 X:31670762-31670784 TTTTATAAGAAGAGGAAAAGAGG - Intronic
1189026802 X:37403756-37403778 TTCCATCAGAAGAAGCAAGGAGG + Intronic
1189816616 X:44830525-44830547 TTCTAACAGATTAAGAAGGGAGG - Intergenic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1190547886 X:51548551-51548573 TGCTATCAGAAGAACAACAAGGG - Intergenic
1191891583 X:65948541-65948563 CAGTATCAGAAGAAGAAAAGGGG - Intergenic
1191962384 X:66718280-66718302 TAATATAAGAAGGAGAAGAGGGG + Intergenic
1192087252 X:68112875-68112897 TTCCATCAGAACAAGAACATTGG - Intronic
1192443959 X:71196188-71196210 TTCTATCAGAAGAAGGGGTTGGG + Intergenic
1192700188 X:73460795-73460817 TTCTTTGAACAGAAGAAGAGCGG - Intergenic
1192927022 X:75765846-75765868 GTCTATCAGAAGGTGAAGATTGG + Intergenic
1194136774 X:90153751-90153773 TTCAATCAAAAGAAATAGAGTGG + Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1195618715 X:106932652-106932674 TACTATCAGAGGAATGAGAGAGG - Intronic
1196065119 X:111455788-111455810 TTCTATCAGAGGCAGGAGGGTGG + Intergenic
1196352898 X:114754050-114754072 TCCTTTAAGAAGAAGAAAAGTGG - Intronic
1196874041 X:120141080-120141102 TTTTTTTAGAAAAAGAAGAGGGG - Intergenic
1197443675 X:126522144-126522166 TTCTATGAAAGGAAGAACAGTGG + Intergenic