ID: 1150207010

View in Genome Browser
Species Human (GRCh38)
Location 17:63416785-63416807
Sequence TCCAGGGTGCTGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150207002_1150207010 2 Left 1150207002 17:63416760-63416782 CCATGGCCCTCAGAGGCAGAGTT 0: 1
1: 0
2: 4
3: 44
4: 395
Right 1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG 0: 1
1: 0
2: 0
3: 36
4: 330
1150207003_1150207010 -4 Left 1150207003 17:63416766-63416788 CCCTCAGAGGCAGAGTTGCTCCA 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG 0: 1
1: 0
2: 0
3: 36
4: 330
1150206998_1150207010 25 Left 1150206998 17:63416737-63416759 CCTGACTGTCTCAGAGAACACGG 0: 1
1: 1
2: 1
3: 12
4: 115
Right 1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG 0: 1
1: 0
2: 0
3: 36
4: 330
1150207004_1150207010 -5 Left 1150207004 17:63416767-63416789 CCTCAGAGGCAGAGTTGCTCCAG 0: 1
1: 0
2: 27
3: 286
4: 1139
Right 1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG 0: 1
1: 0
2: 0
3: 36
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150207010 Original CRISPR TCCAGGGTGCTGAGGGAAGT GGG Intronic
901120506 1:6888345-6888367 TTCAGGGTGCTGTGAGAAGCTGG + Intronic
902134614 1:14294177-14294199 TGCATGATGCTTAGGGAAGTTGG - Intergenic
902381739 1:16055966-16055988 TGCAGAGAGATGAGGGAAGTGGG + Intronic
902466231 1:16620334-16620356 TGCAGGGTGCAGAGGGAAACAGG + Intergenic
903330095 1:22592900-22592922 TTCTGGATGCTGAGGGAAGGGGG - Intronic
905881235 1:41465370-41465392 TCTAGTCTGCTGATGGAAGTTGG - Intergenic
906658440 1:47565675-47565697 TGCAGGGTGCAGAGGGAAAAAGG - Intergenic
906704079 1:47882035-47882057 TCCAGGCTTCTGAGGGCAGAAGG - Intronic
907491792 1:54813252-54813274 ACCAGGCTGCTGTGGGATGTTGG - Intronic
908089309 1:60669724-60669746 TCCAGGGTGATGACAGAAATCGG + Intergenic
911964645 1:104350863-104350885 GCCAGGGTGGTGGGGGAAGCAGG - Intergenic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
912594332 1:110859058-110859080 TCCAGGTCACTGAGGGATGTAGG + Intergenic
912948190 1:114102156-114102178 TCAAGGCTGCTGAGGGAAATAGG - Intronic
913345988 1:117811649-117811671 CCCAGGGTGCTGTGGGAACTTGG - Intergenic
914934713 1:151968425-151968447 CCTAGGGTGCTGAAGGAACTTGG - Intergenic
915547263 1:156607513-156607535 CCCTGAGTGCTGAGGGAGGTGGG + Intergenic
920336177 1:205246899-205246921 TGCAGGGGCCTGGGGGAAGTGGG + Intronic
922275067 1:224069961-224069983 TCCAGGAGGCTGAGGCAAGAGGG - Intergenic
922911976 1:229225770-229225792 TCCAGAGTACTGTGGCAAGTGGG - Intergenic
923928335 1:238661988-238662010 TCCAAAGTGCTGGGGGAAGTCGG - Intergenic
924188344 1:241519718-241519740 TACATGGTGCTGAGGGAGCTTGG + Exonic
924410810 1:243803336-243803358 TCCAGGTTGGTGGGGCAAGTGGG + Intronic
924770307 1:247074257-247074279 TTCAGGGGCCTGAGGGAAGGAGG - Intronic
1063907658 10:10797700-10797722 TCCAGGATCCTGAGGGCAGGAGG + Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1064143733 10:12810961-12810983 CCCAGGGGGCTGAGGGGAGAGGG + Intronic
1067056575 10:43056092-43056114 TCCAGGTTGCTGGAGGAAGCTGG + Intergenic
1067572949 10:47384751-47384773 GCCAGGCTGCTGGGGGAAGGAGG - Intergenic
1067661046 10:48236431-48236453 TGGAGGGTGGCGAGGGAAGTGGG - Intronic
1069532088 10:69227116-69227138 TGCAGCTTGCTGAGGGATGTCGG + Intronic
1069816637 10:71200203-71200225 TCCAGGGTACTGGGGCAAGAGGG + Intergenic
1069823203 10:71240010-71240032 TCCAGGCGGGTGAGGGAAGGTGG + Intronic
1069957587 10:72061416-72061438 CCCTGGGGGCTGAGGGAAGTGGG + Exonic
1070574378 10:77666540-77666562 TCCAGTGAGCTGGGAGAAGTAGG - Intergenic
1072905764 10:99451771-99451793 TCAAGGGTGCTGTGGGCAGAAGG - Intergenic
1073067772 10:100773922-100773944 TCCTGGGAGCTGGGGGAAGCAGG - Intronic
1073190954 10:101650420-101650442 TGCAGGGCTCTGAGGGAGGTGGG - Intronic
1073257503 10:102162740-102162762 TCTAGGGTTTTGAGGGAAGGAGG - Exonic
1073390905 10:103175763-103175785 TCCAGGGTGCTGAGGCCAAGGGG + Intronic
1075397536 10:122138668-122138690 CCCAGCGTGCTGAGTGAATTGGG + Intronic
1075400634 10:122159092-122159114 TCCAGGGAGCTGGGGGAGCTGGG + Intronic
1076078551 10:127557130-127557152 TCCAAGGTGCTGAGGGGATTTGG + Intergenic
1076316905 10:129548690-129548712 TGCAGGGTGCTGGGGGCAGTGGG + Intronic
1076355153 10:129847116-129847138 TGCAGGGACCTGAGGGGAGTGGG + Intronic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076875168 10:133212386-133212408 TCCCGGGTGCTCAGGGGAGGAGG + Intronic
1077051691 11:569459-569481 GCCAGGGAGCTGAGGGGAGACGG - Intergenic
1077613313 11:3658534-3658556 CCCCGGGTGCTGGGGGAAGAGGG - Intronic
1078088678 11:8250574-8250596 TCCAGGGAGCAGTGGGCAGTGGG - Intronic
1078228107 11:9411871-9411893 TTCAGGGTATTGAGGGAGGTAGG + Intronic
1081027578 11:38035057-38035079 TCCCGGATGCTGAGCGAAGCAGG + Intergenic
1081765575 11:45607831-45607853 TCCAGGATGCTGGGGGATGAAGG - Intergenic
1081854467 11:46295105-46295127 GCCAGGGACCTGAGGGAAGAGGG + Intronic
1082004610 11:47412582-47412604 TCCTGGGAGCTGCGGGAGGTTGG + Intronic
1084164850 11:67370803-67370825 GCCAGGGTGCTTAGGGTGGTAGG + Intronic
1084500914 11:69534623-69534645 TCTAGGGAGCTCATGGAAGTGGG - Intergenic
1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG + Intronic
1088200396 11:107326557-107326579 TCCTTGGTTCAGAGGGAAGTGGG - Exonic
1088683547 11:112265803-112265825 TCCAGGGAGCTGGGGGTAGCTGG + Intronic
1089117251 11:116105645-116105667 TCCATGGTGCCAAGGGAAGCTGG - Intergenic
1089296175 11:117469693-117469715 ACCAGGGAGGAGAGGGAAGTGGG + Intronic
1089665276 11:120014095-120014117 TCCAGGGTGCTGCGAGCAGCGGG + Intergenic
1089759414 11:120712147-120712169 TACAGGGTGCTAAGGGAACCTGG + Intronic
1090422633 11:126586000-126586022 TCCAAGCTGCTGAGGGAATTAGG - Intronic
1090626931 11:128616071-128616093 TGCAGGTTGCTGAGGGCAGCTGG + Intergenic
1091758418 12:3071466-3071488 TCCAGGGTGATGATGGAGGAAGG + Intergenic
1091801735 12:3328780-3328802 CCCGGGGTTCTGAGGGGAGTCGG - Intergenic
1092535013 12:9379192-9379214 CACAGGGTGCTGAGGGCAGGAGG + Intergenic
1095378919 12:41565772-41565794 CCCAGTGTCCTGAGGGAAATAGG - Intronic
1095573926 12:43713162-43713184 GCCAGTGTGCAGAGGGAAGGAGG - Intergenic
1096984033 12:55744765-55744787 TGCAGGGGGCTGTGGGAAGGGGG - Intronic
1097053679 12:56238042-56238064 CCCAGGGTGCCGAGGGCAGCAGG - Exonic
1098515787 12:71375237-71375259 GCTAGTGGGCTGAGGGAAGTAGG - Intronic
1098522764 12:71452012-71452034 TTCAGTGTGCTGTGGGATGTAGG - Intronic
1099182267 12:79482508-79482530 TCCAGGTTGGTGAGTGAGGTGGG + Intergenic
1100113725 12:91277208-91277230 TCTAGGGTTTTGAGGGATGTGGG - Intergenic
1101542125 12:105674819-105674841 TACCAGGTGCTGGGGGAAGTAGG + Intergenic
1102244171 12:111344607-111344629 TGGAGGGAGCTGAGGGAGGTGGG + Intronic
1102986520 12:117282943-117282965 TACACTGTGCTGAGGGAAGCAGG - Intronic
1103002606 12:117396611-117396633 TGCAGGGTACTTAGGGAAGGAGG + Intronic
1104063704 12:125288898-125288920 CCCAGGCTGCTGATGGTAGTTGG + Intronic
1106234497 13:27850738-27850760 ACCACTGTGCTGAGGGAAGCAGG + Intergenic
1107300868 13:38964348-38964370 TCTGGGGTGGTGGGGGAAGTTGG - Intergenic
1108492858 13:50998858-50998880 TCCAGGGTGGGGAGAGAGGTGGG - Intergenic
1109261707 13:60152327-60152349 TTCTGTGTGCTGAGGGATGTGGG - Intronic
1110355060 13:74558078-74558100 TCAAGGGTGAAGAGGGAAGGAGG - Intergenic
1112596864 13:100815426-100815448 TCCAAGGTGCTAGGGGAATTTGG - Intergenic
1113582623 13:111439831-111439853 TCCAGGGTGCCCAGGGCATTGGG - Intergenic
1114069957 14:19098459-19098481 TCCCGGTTGCTGAGCGGAGTCGG + Intergenic
1114229583 14:20768409-20768431 TCCAGGGCCCTGAGGAAAGGAGG + Exonic
1116199337 14:41771129-41771151 TCAAGGCTGCTCAGGGCAGTGGG + Intronic
1117476004 14:56095756-56095778 TTCAGGATCCTGAGAGAAGTTGG + Intergenic
1119711827 14:76828058-76828080 TCCAGGGAGCAGAAGGGAGTTGG + Intronic
1120440773 14:84536128-84536150 CACAGGGTGCTGAGGGAAAAAGG - Intergenic
1121443547 14:93964302-93964324 GCGAGGCTGATGAGGGAAGTGGG - Intronic
1121585317 14:95059312-95059334 GTCAGGGTGCTGAGGGAGGCAGG + Intergenic
1122070860 14:99204512-99204534 TCCACAGTGCTCAGGGAGGTGGG + Intronic
1122107692 14:99470901-99470923 GCCAGGGGGCTGAGGGAAGGTGG - Intronic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1125521113 15:40348361-40348383 TGCAGGGTGGGGAGGGAGGTGGG - Intergenic
1128555261 15:68627470-68627492 TCCAGGATGCAGAGAGAAGAGGG + Intronic
1128747614 15:70125472-70125494 TGCTGGCTGCTGAGGGAAGGAGG - Intergenic
1129299786 15:74618928-74618950 GCCTGGGTGCTCAGGGAACTGGG - Intronic
1129907390 15:79198084-79198106 TGCAGGCTGCAGAGGGAAGCAGG - Intergenic
1131002200 15:88947975-88947997 TTCATGGGGGTGAGGGAAGTGGG + Intergenic
1131094110 15:89645327-89645349 TCCAGGGTCCAGAGGTAAGCTGG - Exonic
1131533861 15:93217410-93217432 TCCTGGGTCCTGAGGGAAGCTGG + Intergenic
1132215054 15:100056427-100056449 ACCAGGGGGTTGGGGGAAGTGGG + Intronic
1132929840 16:2453470-2453492 TCCCCTGTGCTGAGGAAAGTCGG - Exonic
1134110538 16:11512888-11512910 CCCATGGTGCAGAGCGAAGTCGG + Intronic
1134257348 16:12623089-12623111 TCCTGGGTACTGAGGCAACTGGG + Intergenic
1134835592 16:17358019-17358041 TCCAGGGTGATGAGCGGACTTGG + Exonic
1136411025 16:30077115-30077137 TTCAGAGTTCTGTGGGAAGTAGG + Intronic
1136997155 16:35198434-35198456 TCCAGGCCGCTGAGGGGAGCAGG - Intergenic
1137985552 16:53104423-53104445 TCCAGGGTGATGAGTTGAGTTGG - Intronic
1139948980 16:70660175-70660197 TCCAGGGTGCTCAGGGCAAGAGG - Exonic
1140219437 16:73033173-73033195 TCCAGGGTACTGGGGGTAGGGGG - Intronic
1140250445 16:73289923-73289945 TCAGGGGTGCTGAGGAAAGGTGG + Intergenic
1141677073 16:85523623-85523645 TCCAGGGGGCTGAGGGACAGAGG + Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142238891 16:88936121-88936143 TCCCGGGTACTCAGGGAGGTCGG + Intronic
1142606911 17:1087209-1087231 ACCAAGGTGCTGGGGGAAGTGGG + Intronic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1143104142 17:4520008-4520030 TCCAGGGTCAGGAGGGAGGTGGG - Intronic
1143106609 17:4533449-4533471 TCAAGGGTGCTGGGGGAGCTGGG + Intronic
1143420357 17:6786357-6786379 TAGGGGGTGCAGAGGGAAGTGGG + Intronic
1143452216 17:7042916-7042938 TCCTCGCTGGTGAGGGAAGTGGG - Exonic
1143783873 17:9242864-9242886 TCCAAGGAGCAGAGGGAAATGGG + Exonic
1144919707 17:18753165-18753187 TCTAGGGCACAGAGGGAAGTGGG + Intronic
1145970990 17:28956434-28956456 TCCAGGGTGCTGGAGGCAGCAGG + Exonic
1147548751 17:41423001-41423023 TCCAAGGTGGTGTGGGAGGTAGG - Intronic
1147550708 17:41439427-41439449 TCCAAGGTGGTGTGGGAGGTAGG - Intronic
1148026231 17:44589643-44589665 TTCAGTGTTCTGAGGGAAGGCGG + Intergenic
1148229321 17:45921434-45921456 TCCAGGCTGGTGAGGCAAGGAGG - Intronic
1148977174 17:51539592-51539614 TGCAGGCTGCTGAGGGTAGAGGG + Intergenic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1150612121 17:66741854-66741876 TCCAGGGTGAGGAGGAAGGTGGG - Intronic
1151624258 17:75266837-75266859 GCCAGGGAGCTGAGGCCAGTTGG + Exonic
1152473085 17:80501000-80501022 CCAAGGGTGCTGAGGGCAGGAGG - Intergenic
1152520811 17:80855567-80855589 ACCTGGGGGCTGAGGGAGGTGGG + Intronic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1152584787 17:81184108-81184130 GCCAGGGTGGTGCGGGCAGTGGG - Intergenic
1152606947 17:81296119-81296141 TCCAGGCTGCTGGGGGAGGACGG + Intergenic
1153378655 18:4411111-4411133 TCCAAGGGGCTGAGAGAAGTAGG - Intronic
1157383831 18:47246713-47246735 TCCAGGCTGCTGCAGGAAGACGG - Intronic
1157404066 18:47408956-47408978 TCCAGAGAGGTGAGGGAACTTGG + Intergenic
1157476238 18:48025366-48025388 CCCAAGGTGCTAAGGGAGGTGGG - Intergenic
1158900643 18:61958620-61958642 TCGAGGCTGCGGAGGGAAGCAGG + Intergenic
1159582983 18:70253668-70253690 TCCAGGGTGCTGAGGGTGAAGGG - Intergenic
1160329433 18:77978161-77978183 TCCAGGGTGCAGGGGGAAGCTGG - Intergenic
1161067065 19:2243888-2243910 TCCACGGTGCTGAGGGGACTCGG - Intronic
1161361123 19:3850303-3850325 TCCTGGGTGCTGAGGGACAGAGG + Intronic
1162233935 19:9290221-9290243 TTCAGGAGGCTGAGGCAAGTGGG + Intergenic
1163688329 19:18724979-18725001 GCCAGTGTGCTGAGGGAAGCTGG - Intronic
1163787228 19:19281073-19281095 TACAGGGCACTGAGGGATGTGGG + Intronic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1164466733 19:28493470-28493492 CCCAGGGTGCTGAAGCAAGAAGG + Intergenic
1165383373 19:35496068-35496090 TCCAGGATGCAGAGGGAGGGAGG - Intergenic
1166328487 19:42065541-42065563 TCCTGGGTCCTGGGGGAAGGAGG + Intronic
1166546055 19:43635483-43635505 TCCTGGGTCCTGAGGGAGGAAGG - Intronic
1167373386 19:49098188-49098210 TCCAGGCTGCTGAGGAGAGGAGG - Intronic
1167701029 19:51045972-51045994 TCCAGGCTATTGAGGGCAGTGGG - Intergenic
1167904447 19:52647138-52647160 TGCAGGGTGGTGTAGGAAGTGGG - Intronic
1168112720 19:54203096-54203118 CCCAGGGTTCTGTGGGGAGTGGG + Intronic
1168158399 19:54491760-54491782 TCCAGGGTTCTAGGGGAGGTTGG + Intergenic
1168258846 19:55181633-55181655 TCCTGGGTGCTGTGGGAGGAGGG - Exonic
1168271412 19:55251780-55251802 ACCAGCGTGCTGAGGGAAGCGGG + Intronic
925005691 2:441463-441485 GTCAGGGTGGTGAGGGAAGCAGG - Intergenic
925292590 2:2757514-2757536 TCCATGTTGATGAGGGAAGGTGG - Intergenic
925360730 2:3278504-3278526 GCCAGGGTGCTGTGGGGACTGGG - Intronic
925978953 2:9161631-9161653 TCCAGGCTGCTGAGGACAGTTGG + Intergenic
926150838 2:10424847-10424869 TCCAGGGTGGCCAGGGAAGTTGG - Intronic
926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG + Intergenic
926800979 2:16660454-16660476 TGCAGTGTGCTGAGGGAAGAGGG - Intronic
928657058 2:33463501-33463523 TCCAGGATGCTGAAGAAAGGGGG + Intronic
929948783 2:46390229-46390251 ATAAGGGTGCTGCGGGAAGTAGG + Intergenic
931638557 2:64361971-64361993 TCCAAGGCGCTGAGCGTAGTAGG - Intergenic
933677166 2:85067087-85067109 TCCAGGCAGCTGTGGGAATTGGG + Intergenic
933691484 2:85182373-85182395 GCCAGGGAGCTGAGGGTAGAAGG + Intronic
934844851 2:97656190-97656212 CCCAGGGTGCCGAGGGTAGAGGG + Exonic
935239719 2:101168065-101168087 TCAAGGCTGCTCAGGGCAGTGGG - Intronic
935832975 2:107019651-107019673 TACAGGGCGCTGAGGCAAGTAGG - Intergenic
936283821 2:111165463-111165485 TCTATGGTGCTGGTGGAAGTGGG - Exonic
937438156 2:121896231-121896253 AACAGGGAGCTGCGGGAAGTGGG + Intergenic
937690737 2:124752159-124752181 GCCAGGGTGCTTAGGGAAACTGG + Intronic
937940354 2:127280438-127280460 TCCAGTGTGCTGAGGTAGCTGGG - Exonic
938307776 2:130266581-130266603 TTCAGGGTGCAGATGGAAATCGG + Intergenic
938447562 2:131390260-131390282 TTCAGGGTGCAGATGGAAATCGG - Intergenic
941702093 2:168614603-168614625 TGCAGGTTGGTCAGGGAAGTGGG - Intronic
943247377 2:185473152-185473174 GCCAGGGGGCTGAGGGAGGGCGG + Intergenic
944023261 2:195131918-195131940 TACCGGGTTCTGTGGGAAGTGGG - Intergenic
946152547 2:217786039-217786061 TCCAGGCTGCACAGGGAAGCAGG - Intergenic
1169075017 20:2755038-2755060 CCCAGGGTGCAGGGGGAAGTGGG + Intronic
1171326297 20:24296513-24296535 TCCAGGGTGCTCAGGCATGGAGG - Intergenic
1173396927 20:42688756-42688778 ACCAGGGTGCTGAGAACAGTGGG - Intronic
1174180732 20:48672714-48672736 AGCAGAGGGCTGAGGGAAGTGGG - Intronic
1175300921 20:57942174-57942196 TCGGGGGTGCTGAGGGGAGTGGG + Intergenic
1175641474 20:60633948-60633970 TCCAGGGAGCCAAGGGGAGTAGG + Intergenic
1175975148 20:62707374-62707396 CGCAGGGTGTTGAGGGAAGCGGG - Intergenic
1180488425 22:15821023-15821045 TCCCGGTTGCTGAGCGGAGTCGG + Intergenic
1180608345 22:17078768-17078790 TCCAGGAGGCTGAGGCAAGAGGG + Intergenic
1180872486 22:19154502-19154524 TCCAGGGTGATGAGTCAAGGTGG - Intergenic
1180960986 22:19762257-19762279 TGGAGGGTGCTGCGGGACGTGGG - Intronic
1181883184 22:25997813-25997835 CCCAGGGTGATGAGGAAATTAGG - Intronic
1182358121 22:29731421-29731443 GCCAGGGTGGTGAGGCAGGTGGG - Exonic
1182574336 22:31262724-31262746 TCCAGGGTGCTGAGGGCGTGGGG - Exonic
1183023076 22:35043027-35043049 GCCAAGGTGGTGTGGGAAGTGGG + Intergenic
1183219955 22:36506264-36506286 TCCAGCGCGCTGCAGGAAGTAGG + Exonic
1183239303 22:36644429-36644451 TCCAAGGTGCTGAAGCAAGTGGG + Intronic
1183593186 22:38793759-38793781 ATCAAGGTGCTGGGGGAAGTCGG + Intronic
1184003313 22:41690869-41690891 ATCATGGTGCTGAGGGAAGAAGG - Intronic
1184131344 22:42518508-42518530 TCCAAGGTGCTGGGGGAAGATGG - Intronic
1184141566 22:42580720-42580742 TCCAAGGTGCTGGGGGAAGATGG - Intergenic
1184281552 22:43440406-43440428 GCCAGGGTGCTGAGGGCAGGAGG + Intronic
1184573755 22:45345398-45345420 GTCAGGGTACTAAGGGAAGTTGG + Intronic
1184747425 22:46464502-46464524 GCCAGGGTGCTGAAGGAGGAAGG - Intronic
1185108008 22:48885264-48885286 TCCAGGTTTCTGGGGGGAGTGGG + Intergenic
949765062 3:7517000-7517022 TCAAGTGTGCTGAGGGGAGCGGG - Intronic
950124255 3:10501874-10501896 CCCAGGGTGCGGAGTGAAATGGG + Intronic
950444268 3:13027186-13027208 TCCAGGGTGCTGAGAGCGTTGGG + Intronic
953024920 3:39139243-39139265 CCCAGGATGCTGTGGGCAGTGGG + Intergenic
953207039 3:40840329-40840351 ACCGGGGTGCTGAGGGCAGGGGG + Intergenic
953277706 3:41519385-41519407 TCCACGGTAGTGAGGCAAGTAGG - Intronic
954238734 3:49277064-49277086 GCCAGGAAGCTGTGGGAAGTGGG - Exonic
954755731 3:52838655-52838677 GCCAGGGTGCTGAGAGGAGCAGG - Exonic
954842363 3:53523154-53523176 TGCAAGATGCTGAGTGAAGTGGG + Intronic
955055921 3:55456171-55456193 TTCAGGGTGAAGAGGGAAGGGGG + Intergenic
956606671 3:71079745-71079767 TGCTGGGTGCTGAGTGAAGGTGG - Intronic
956695480 3:71915705-71915727 TCCAAGAAGCTGAGGGAATTGGG + Intergenic
957007022 3:74961249-74961271 ACCAGGGTGCTTAGCAAAGTTGG + Intergenic
959283360 3:104376506-104376528 TTTAGGGTGCTGGAGGAAGTTGG + Intergenic
960969475 3:123129411-123129433 ACCCGGCTGCGGAGGGAAGTGGG + Intronic
961651478 3:128418660-128418682 TCAAGGGTGCTGGGCAAAGTTGG - Intergenic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
961955121 3:130793795-130793817 TTCAGGATAATGAGGGAAGTTGG - Intergenic
963451160 3:145482932-145482954 GGCGGGGGGCTGAGGGAAGTGGG - Intergenic
964087402 3:152834978-152835000 TCCAGGGCGCAGTGGGAAGCAGG - Exonic
965821896 3:172692605-172692627 TCTAGGAGGCTGAGGCAAGTGGG - Intronic
967770155 3:193325710-193325732 TCCAGGGTGCTTCAAGAAGTAGG - Intronic
969325264 4:6440479-6440501 GCCATGGTGCTGAGGGAGCTTGG - Intronic
969842461 4:9892396-9892418 TCCTGGGTGCTTAGGGAAGAAGG + Intronic
970614764 4:17758767-17758789 TGCAGAGTGCTGTGGGAAGGGGG - Intronic
972371653 4:38429911-38429933 TCTGGGGTGCTTAGAGAAGTAGG - Intergenic
972769294 4:42181514-42181536 TCCAGGGTGCGGAAGGAAGGTGG + Intergenic
973214998 4:47658460-47658482 TTCATGGAGCTGTGGGAAGTAGG - Intronic
974972017 4:68842446-68842468 TCCAGGGTCCTGAAAAAAGTTGG - Intergenic
978610798 4:110536674-110536696 TCCAGTGTGCCCATGGAAGTAGG - Intronic
984494429 4:180476583-180476605 GCAAGGGTGCTGAAGGAAATAGG - Intergenic
985188475 4:187345248-187345270 TCCAGTGTGTTGTGGGATGTGGG - Intergenic
985410395 4:189677994-189678016 TGCAGGGTGCTGAGGAATGCAGG + Intergenic
986444677 5:7811077-7811099 TCCAGGTTGTTGGGGGAAATGGG - Intronic
987073917 5:14362735-14362757 CTCAGGGTCCCGAGGGAAGTGGG - Intronic
988481735 5:31637569-31637591 TCATTGGTGCTGAGGGAGGTAGG + Intergenic
990815722 5:59782974-59782996 GCCAGGATGCAAAGGGAAGTTGG - Intronic
994590111 5:101761348-101761370 GCCAGGGAGCTGAAGGAACTTGG + Intergenic
995201026 5:109425410-109425432 ACCAGGGCACTGAGGGAAGCAGG - Intergenic
998159389 5:139804576-139804598 TCCAGTGGGCTAGGGGAAGTTGG - Intronic
999453692 5:151697538-151697560 TCCAGGGCTCTGTGGGAAGGGGG + Intergenic
1000014845 5:157267144-157267166 TCCACTGTGCTGGGGAAAGTAGG - Intronic
1001580186 5:172792869-172792891 CCCAGAGTGCTGGGTGAAGTGGG + Intergenic
1001772854 5:174308946-174308968 GCCAGGGTGATGGGGGAAGCTGG - Intergenic
1001833519 5:174809884-174809906 TTCAGGATGTTGAAGGAAGTGGG - Intergenic
1002716923 5:181233816-181233838 GACTGGGTCCTGAGGGAAGTTGG + Intronic
1003193566 6:3895192-3895214 TCAAGCCTGCTGTGGGAAGTGGG + Intergenic
1003571259 6:7258095-7258117 ACCAAGGAGCTGAGGGAGGTGGG - Intergenic
1004803805 6:19180082-19180104 TGCAAGGTGCTGAGGAATGTAGG + Intergenic
1005956170 6:30665062-30665084 TCCAGGGTGATGAGGTAAGAGGG - Exonic
1006411473 6:33876489-33876511 TGCAGGATGCTGAGGGCAGGCGG - Intergenic
1006521693 6:34574730-34574752 CCCAGGGTGCTGAGGAAGGAAGG - Intergenic
1006989878 6:38206030-38206052 TCCAGACTGCAGAGGGAAGGCGG + Intronic
1008134836 6:47762724-47762746 TCCAGGGGGCTGAGGAAAGGAGG - Intergenic
1008143259 6:47857011-47857033 TCAAGGTTGCTTAGGGAAATTGG + Intergenic
1010589046 6:77691620-77691642 TACAAGGTACAGAGGGAAGTTGG + Intronic
1011258785 6:85450573-85450595 TCCAGGGCGCGGAGAGATGTGGG + Intronic
1011669853 6:89673102-89673124 TCCAGGGTTCTGAGGCAGGGAGG - Intronic
1012057142 6:94427440-94427462 TACAGGGTGATAGGGGAAGTAGG - Intergenic
1013633964 6:112010929-112010951 CTTAGGGTGCTGGGGGAAGTAGG - Intergenic
1014561261 6:122893646-122893668 CCCAGGGTGCTGTGAGAAGAAGG + Intergenic
1016649140 6:146444079-146444101 TCCACAGAGCTGAGTGAAGTAGG + Intergenic
1018368860 6:163149429-163149451 TCCAGGGTTCGCAGGGAAGGAGG - Intronic
1018437433 6:163775546-163775568 CCCAGTGTGCTCAGGTAAGTGGG + Intergenic
1019397544 7:830132-830154 TGCAGGGTGGGGAGGGGAGTTGG + Intronic
1020050151 7:5076130-5076152 TCCATGGTGCAGAGGGAACCTGG - Intergenic
1020947753 7:14635721-14635743 GACAGGGATCTGAGGGAAGTTGG + Intronic
1022684454 7:32583260-32583282 TTCAGAATGCTGAGGCAAGTAGG + Intronic
1022796975 7:33739645-33739667 TCCAGGGTGATGAGGTGACTAGG + Intergenic
1022973714 7:35538636-35538658 TACAGGGTGCTGTGGGAGGAAGG - Intergenic
1024224549 7:47315527-47315549 TCCAGGCTTCTGTGGGAAGCTGG + Intronic
1024257060 7:47547147-47547169 TCCAGGGTGAGGAGGGAGGGAGG + Intronic
1026260995 7:68755308-68755330 TACAGGGTCCTGAGGAATGTGGG - Intergenic
1027133586 7:75608980-75609002 TCCAGTGTGCTAAGGAAAGTGGG + Intronic
1029112999 7:98223068-98223090 GCCCGGGTGCCGAGGGGAGTGGG - Exonic
1029493666 7:100885614-100885636 CCTAGGGTTCTGAGGGCAGTGGG + Intronic
1030293340 7:107893629-107893651 GGCAGGGTCCTGAGTGAAGTGGG + Intronic
1031572519 7:123376672-123376694 TCCTGGTTACTGAGGGAGGTTGG + Intergenic
1032350435 7:131158006-131158028 TCCATGCTGCAGTGGGAAGTGGG + Intronic
1034228710 7:149502168-149502190 TCCAGGGTGAGGAGGGATGTGGG - Intergenic
1035049699 7:155991726-155991748 TCCAGGGTCGTGGGGGAAGGAGG + Intergenic
1036543462 8:9742386-9742408 GCGAGATTGCTGAGGGAAGTGGG - Intronic
1037632293 8:20669186-20669208 TCCAGGCAGGTGAGGGGAGTAGG - Intergenic
1039393915 8:37206569-37206591 TCCAGGGTGCAGAGAGCACTTGG - Intergenic
1039395406 8:37221260-37221282 ACCAGGGTGCTGGGGCAGGTAGG - Intergenic
1039665479 8:39522614-39522636 CCCAGGCTGCAGTGGGAAGTGGG - Intergenic
1040545153 8:48393268-48393290 CTCAGGGTGCTGTGAGAAGTGGG + Intergenic
1041780391 8:61572639-61572661 GCCATGGAGATGAGGGAAGTGGG - Intronic
1043455402 8:80407351-80407373 TCCAGGGTTCCTGGGGAAGTGGG - Intergenic
1043973810 8:86563178-86563200 TCCATGGTGATGAGGAAAGAGGG + Intronic
1044418268 8:91961140-91961162 TCCAGGGAGCTGAGGTAAAGGGG - Intronic
1044553825 8:93540699-93540721 TCCAGGCTTTTGAGGGCAGTTGG - Intergenic
1047778281 8:128091431-128091453 GCCAGGGTGCTGTGTGATGTGGG - Intergenic
1048012577 8:130469951-130469973 TTCAGGGTGCTGAGGCTATTCGG + Intergenic
1049157587 8:141076322-141076344 TACAGGGTGCTATGGGATGTTGG + Intergenic
1049495068 8:142926233-142926255 CGCAGGGTGCTGAGGCAGGTGGG - Intergenic
1049613232 8:143565449-143565471 TCCAGCGTGCTGTGGGGTGTGGG + Intergenic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049783447 8:144439381-144439403 GCCAGGCAGCTGTGGGAAGTTGG - Intronic
1050287284 9:4117085-4117107 CCTTTGGTGCTGAGGGAAGTGGG - Intronic
1052271229 9:26630291-26630313 TCCAGAGACCTGAGGGAAGGTGG + Intergenic
1053382346 9:37659316-37659338 GCCAGGATGCTGAAGGAAGGAGG - Intronic
1054743825 9:68834392-68834414 TGCAGGGTGCTGAGGGAGGCTGG - Intronic
1054768822 9:69066085-69066107 GCCAGGCTGCTGAGGGATGAGGG - Intronic
1054915404 9:70490992-70491014 TCCAGGCTGCTGAGGAGAGATGG + Intergenic
1055454278 9:76458654-76458676 TCCACAGTGCTGTGGAAAGTAGG - Intronic
1055520321 9:77074232-77074254 TCCAGCATCCTGAGGGAAGCTGG - Intergenic
1055801777 9:80045363-80045385 TCGGGGGTGCTGAGGTAAGAGGG - Intergenic
1056126416 9:83539262-83539284 TCCAGGGTGTTGAAGGTAGGAGG + Intergenic
1057571933 9:96211096-96211118 TCCAGCCTCCTGAGGGAAGAGGG + Intergenic
1058372685 9:104288179-104288201 TCCATGGGGCTAAGGAAAGTTGG - Intergenic
1058425690 9:104873999-104874021 GGCAGGGAGTTGAGGGAAGTGGG - Intronic
1058942771 9:109829418-109829440 TCCAGGGTGCTGGGGAAACAAGG - Intronic
1059436864 9:114282384-114282406 TCCAGGGAGGGGAGGGATGTGGG - Intronic
1060475145 9:123981160-123981182 TCCATGGTGATGAGTGTAGTTGG - Intergenic
1060742492 9:126108700-126108722 TCTAGAGTGTTGAGGGAATTGGG - Intergenic
1061392295 9:130324178-130324200 CCCAGGGGGCTGAGGGGAGACGG - Intronic
1061778712 9:132983506-132983528 TGCAGGGTGCTGGGGCAAGAGGG - Intronic
1062049441 9:134439470-134439492 TCCAGGGTGCGGAGGGCCGGCGG - Intronic
1062151663 9:135022479-135022501 TCCAGGGTGTTGCCGGAAGTCGG - Intergenic
1062518973 9:136949821-136949843 TCCAGGGTGCTGAGTGGAAGCGG + Intronic
1203772563 EBV:57093-57115 TCCAGTGTGATGGGGGACGTGGG + Intergenic
1203672363 Un_KI270755v1:27431-27453 TGCAGGGTGCTGAGGAATGCAGG - Intergenic
1186107536 X:6223706-6223728 CCCAGGCTGCTGAGGCAATTAGG - Intronic
1186541800 X:10408847-10408869 ACCAGGGTGCTGAGGGCTGACGG - Intergenic
1186664676 X:11705063-11705085 TCCAGGGTGCTGAGGGCGTGAGG + Intergenic
1187084192 X:16024720-16024742 TCCACAGTGCTGAGGGAGGAGGG + Intergenic
1187672476 X:21682167-21682189 TCCAGGGTAATGAGGGAGGCTGG + Intergenic
1187832874 X:23400560-23400582 TAGAGGTTGCTGGGGGAAGTTGG + Exonic
1189308799 X:40006115-40006137 GCCTGGGGGCAGAGGGAAGTGGG + Intergenic
1190219107 X:48499541-48499563 GCCACGTTGCTGAGGGAAGAGGG + Intergenic
1190701475 X:52992568-52992590 AGCAGAGTGCTGTGGGAAGTGGG - Intronic
1192358092 X:70422298-70422320 TCTGGGGTGATGAGGGAAGGTGG + Intergenic
1193365116 X:80622968-80622990 TCCAGGCAGCTGAGACAAGTGGG - Intergenic
1193468853 X:81875939-81875961 TCCAGGGAGCTGGTGGAAGCTGG - Intergenic
1194125260 X:90008623-90008645 CCCAGGGTGATGAGGGCAGAGGG + Intergenic
1194369564 X:93055682-93055704 TCCATGGTGGTCAGGGATGTGGG - Intergenic
1195346070 X:103952500-103952522 TCCAGAGTCCTAAGGGAAGGGGG + Intronic
1195361539 X:104087026-104087048 TCCAGAGTCCTCAGGGAAGGGGG - Intergenic
1197873201 X:131079470-131079492 TCCTGGCTACTAAGGGAAGTAGG + Intronic
1198428263 X:136541209-136541231 CCCTGCCTGCTGAGGGAAGTTGG + Intronic
1198573707 X:137987072-137987094 TGCAGGGTGCAGAGGGAGGTGGG - Intergenic
1200021529 X:153214764-153214786 TCCAGGCTTCTGAGGGGATTGGG - Intergenic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic
1200096715 X:153667992-153668014 CCCAGGGTGCTGAAGGAACTAGG + Intergenic
1200149100 X:153942786-153942808 CCCAGGGTGCCCAGGGGAGTGGG + Intronic
1200677756 Y:6171894-6171916 TCCATGGTGGTCAGGGATGTGGG - Intergenic
1200801264 Y:7389000-7389022 TCCTGGGTCCTGACGCAAGTTGG - Intergenic
1201375644 Y:13315969-13315991 CCCAAGGTGATGAGGGTAGTTGG - Intronic