ID: 1150207442

View in Genome Browser
Species Human (GRCh38)
Location 17:63419771-63419793
Sequence CAGAGAGGCCAGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1220
Summary {0: 1, 1: 0, 2: 5, 3: 139, 4: 1075}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150207432_1150207442 26 Left 1150207432 17:63419722-63419744 CCGAAGGGCCTGGCTGGACTGAC 0: 1
1: 0
2: 0
3: 8
4: 171
Right 1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG 0: 1
1: 0
2: 5
3: 139
4: 1075
1150207431_1150207442 27 Left 1150207431 17:63419721-63419743 CCCGAAGGGCCTGGCTGGACTGA 0: 1
1: 0
2: 1
3: 34
4: 268
Right 1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG 0: 1
1: 0
2: 5
3: 139
4: 1075
1150207434_1150207442 18 Left 1150207434 17:63419730-63419752 CCTGGCTGGACTGACAAAATGGG 0: 1
1: 0
2: 0
3: 21
4: 218
Right 1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG 0: 1
1: 0
2: 5
3: 139
4: 1075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150207442 Original CRISPR CAGAGAGGCCAGAAGGAAGA TGG Intronic
900502518 1:3013320-3013342 CAGAGAGACAGAAAGGAAGAGGG - Intergenic
900793112 1:4692343-4692365 CTGAGAGGCCAGAAGGGAAAGGG - Intronic
900877391 1:5352962-5352984 CAGAGAAGCCAGAAGACACAAGG + Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901060506 1:6469702-6469724 CAGAGAGGCCAGCAGGGTCAGGG + Intronic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
902686397 1:18080383-18080405 CAGAGAGGCCAGAATTAAAACGG - Intergenic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903291563 1:22317483-22317505 CAAAGGGGCCAGGAGGAAGGGGG + Intergenic
903298054 1:22358347-22358369 GAGAGAGGACTGAAGAAAGATGG + Intergenic
903476756 1:23624807-23624829 CGGAGATGACAGCAGGAAGAAGG + Intronic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
903699084 1:25232829-25232851 CTGCGAGGCTAGAAGCAAGATGG - Intergenic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
903777964 1:25805345-25805367 CACAGAGGGCAGAGGAAAGATGG - Intronic
904366902 1:30017562-30017584 CATAAAGGCCAGAAGGCAGTAGG - Intergenic
904480734 1:30791720-30791742 AAGAGAGGGAAGAAGGAAGGAGG + Intergenic
904604693 1:31692042-31692064 CAGAAAGGCGAGAAGGGCGACGG - Exonic
904967652 1:34390857-34390879 AAGGGAGGCCAGAAGAAAGTGGG - Intergenic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905286197 1:36882002-36882024 CACAGAGGCCTCAAGGAGGAGGG - Intronic
905291905 1:36927650-36927672 AAGGGAGGCAAGAACGAAGAGGG + Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905993524 1:42360746-42360768 CAGAAAGGACAAACGGAAGAAGG - Intergenic
906012107 1:42537457-42537479 CAAAAAGGCAAGAAGGTAGAGGG - Intronic
906181515 1:43824117-43824139 AATCGAGGACAGAAGGAAGAGGG + Intronic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906322280 1:44824415-44824437 CAGAGATGCCAGAACCAAGGAGG - Intronic
906391846 1:45424289-45424311 CAGAGAGGCCAGGCAGAAGAGGG + Intronic
906758669 1:48348853-48348875 CAAAGAAGCCAGGAGGATGAAGG - Intronic
907279755 1:53339850-53339872 CAGAGTGGCCAGAAGGATCTGGG - Intergenic
907364505 1:53946972-53946994 TAGTGAGGCGTGAAGGAAGAGGG + Intronic
907659595 1:56379675-56379697 AAGAGAGGAAAGAAAGAAGATGG - Intergenic
907925921 1:58955130-58955152 CAGAGAGGGCACCAGGATGAAGG + Intergenic
908855099 1:68417904-68417926 GAGAAAGGACAGAAGGAATAAGG - Intergenic
909343562 1:74558605-74558627 CAGAAGGGACAGAAGGGAGAAGG - Intergenic
910173142 1:84399650-84399672 TAGAGAGGCAAGAAGCAACATGG + Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910647153 1:89525657-89525679 CTGAGAGGTCAGAAGGGAGGAGG + Intronic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
911002409 1:93180192-93180214 CAGAGCGGCCAGAAGGAGCACGG + Exonic
911090607 1:94014244-94014266 GAGAGAGGGCAGAAGGAAAGAGG + Intronic
911183691 1:94883051-94883073 CAGAGAGGCCAGGGGTCAGAAGG + Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911802382 1:102158208-102158230 CACAGAGGCCAGAAGGCAAGTGG + Intergenic
912198588 1:107429136-107429158 AAGAGAGGCAAGAAGAAAGGGGG - Intronic
912425702 1:109587967-109587989 CAGAGAGGAGAGAAAAAAGATGG - Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912557428 1:110526294-110526316 CAGAGAGACTAGATGGGAGAAGG - Intergenic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
912863536 1:113236611-113236633 GAGAGAGGCCAGAGGGATGTGGG - Intergenic
912916198 1:113817087-113817109 CCGAGTGGCAAGAAAGAAGATGG + Intronic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913123258 1:115761650-115761672 GACCGAGGCCCGAAGGAAGAAGG + Intronic
913251741 1:116917474-116917496 CAGAGAGGAGGGAAGGGAGAGGG + Intronic
913963612 1:143357141-143357163 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914057972 1:144182730-144182752 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914121174 1:144783635-144783657 AAGAGAGGAGAGAGGGAAGAGGG + Intergenic
914346998 1:146808482-146808504 AGGAGAGGGCAGAAGGATGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915057894 1:153152656-153152678 CAGGGATGCCAGAAGGAACAGGG + Intergenic
915178943 1:154041684-154041706 AAGAGAGGCAAGTGGGAAGATGG - Intronic
915570382 1:156742252-156742274 TAGAGAGACCAGTAGGAAGAGGG + Intronic
915616408 1:157042947-157042969 CAGAGAGGCCAACAGAAAGGAGG + Intronic
915713382 1:157922294-157922316 AAGAAAGGAAAGAAGGAAGAAGG + Intergenic
915841574 1:159217358-159217380 CACAGAGGCCTGAGGGAAGGTGG - Intergenic
916272788 1:162961877-162961899 AGGAGAGGCAAGTAGGAAGATGG - Intergenic
916277800 1:163013957-163013979 CTGAGAGACCTGAATGAAGATGG - Intergenic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916560588 1:165931280-165931302 CACAGAGCCCAGAAGTAGGAAGG - Intergenic
916604855 1:166330979-166331001 CAGAAAGGCCAGAGGAATGAAGG + Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917572394 1:176281848-176281870 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
917722965 1:177803516-177803538 CTGTGAGGCCAGAAGCAAGGTGG - Intergenic
917921038 1:179750131-179750153 TAGTGAGGCCAGAAGCTAGAGGG + Intronic
917968965 1:180195240-180195262 CTGAGAGGCCAGAAGCAGGGTGG + Intronic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
918922947 1:190738551-190738573 AAGAGATTCAAGAAGGAAGAGGG - Intergenic
919030430 1:192235356-192235378 CAGAGAGGCCTTAAGGGAAAGGG - Intergenic
919207584 1:194437308-194437330 AAGAGAGGCCAGCAGACAGAGGG - Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920059089 1:203215274-203215296 CAGGGAGGCCAGATAGAAGGTGG + Intronic
920255639 1:204652280-204652302 CAGGGAGGCAAGGAGGAAGGCGG - Intronic
920310314 1:205044472-205044494 CAGTGAGGCCAGGAGGGAGTGGG + Intronic
920364255 1:205439848-205439870 GAGAGAGGAAGGAAGGAAGAAGG + Intronic
920764192 1:208815965-208815987 CAGAAAGGCAAAAGGGAAGAAGG + Intergenic
920780303 1:208984576-208984598 CTGAGAGGCAACCAGGAAGATGG + Intergenic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921190232 1:212701179-212701201 CTGAGAGGCGGGGAGGAAGACGG + Intergenic
921740810 1:218682303-218682325 CAGAGATGCCACAAGGAAGGAGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922567165 1:226608235-226608257 CAGGGAGGAAAGAAGGGAGAGGG + Exonic
922899176 1:229123106-229123128 GAGAGAGGCTAGAAGGGACAAGG + Intergenic
923193269 1:231641056-231641078 CTGATAGGCCTGAAGGAAAAGGG + Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923321852 1:232842154-232842176 TAGAGAGGCTTGAAGGATGATGG - Intergenic
923831111 1:237558432-237558454 CATAAAGGCCAGAAGGCAGCGGG - Intronic
924030347 1:239879703-239879725 TGGAGAGACAAGAAGGAAGAGGG - Intronic
924193191 1:241577898-241577920 AGGGGAGGCCAGAAGGAAAAGGG - Intronic
924604903 1:245524974-245524996 CAGAGAGGTAAAGAGGAAGACGG - Intronic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
1062989463 10:1802605-1802627 TAAGGAGGCCAGAAGGAACATGG + Intergenic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063264193 10:4428648-4428670 AATAGAGGCCAGAGGGAAAAAGG - Intergenic
1063449383 10:6141152-6141174 AAAAGATGGCAGAAGGAAGAAGG + Intergenic
1063503083 10:6572134-6572156 CTCAGGGGCTAGAAGGAAGAGGG - Intronic
1063520404 10:6735833-6735855 CAGATAAGCCAGAAGCAAGGTGG - Intergenic
1063687778 10:8254958-8254980 CAAAGAGGGGAGAGGGAAGATGG - Intergenic
1064421731 10:15196687-15196709 AAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1064573763 10:16723724-16723746 CAGCCAGGCCTGCAGGAAGATGG + Intronic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1064883195 10:20080608-20080630 CAGAGAGGCTAGAATAAAGCAGG - Intronic
1064943564 10:20761983-20762005 CAGAGAGGCCCCAAGATAGAAGG - Intergenic
1065077866 10:22098825-22098847 CAGAGGGGTCAGGAGCAAGATGG + Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1065768416 10:29053756-29053778 CAGATAGGCCAGGAGGAATCTGG - Intergenic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1066065136 10:31756334-31756356 CTGACAGCCCAGAAGGAAGGAGG + Intergenic
1066264525 10:33763042-33763064 CAGAGAAGGCATAAGGAACATGG - Intergenic
1066267998 10:33795033-33795055 CTTAGAGGTCAGAAGCAAGATGG + Intergenic
1066300354 10:34090511-34090533 AAGAGAGGCCAGCATGTAGAAGG - Intergenic
1066465187 10:35643689-35643711 AAGAGAGGCAGGGAGGAAGAGGG - Intergenic
1066515177 10:36151048-36151070 CAGAGAGGCAACAAAGAAGCAGG + Intergenic
1066671403 10:37844166-37844188 CATAGAGACCAGAAGGCAGTGGG + Intronic
1066692439 10:38043716-38043738 CGTAGAGGCCAGAAGGAGGCAGG - Intronic
1067395282 10:45910265-45910287 CTGAGAGGACAGAAAGAACATGG + Intergenic
1067520154 10:46994124-46994146 CATATAGGCCAGGAGGAAGTGGG - Intronic
1067557928 10:47285362-47285384 AAGGGAGGCCAGAGGAAAGAAGG + Intergenic
1067800631 10:49356221-49356243 GAGAGAGGCCAGAAGAGAGAAGG + Intergenic
1067841671 10:49685661-49685683 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1067863604 10:49879389-49879411 CTGAGAGGACAGAAAGAACATGG + Intronic
1068493331 10:57752367-57752389 CATAGAGACCAGAAGGCAGTGGG - Intergenic
1068775268 10:60862096-60862118 AAGAGAGGAAGGAAGGAAGAAGG - Intergenic
1068933162 10:62612085-62612107 GAGAGAGGGGAGTAGGAAGAAGG + Intronic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069261508 10:66403791-66403813 CTTAGAGGTCAGAAGCAAGATGG - Intronic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1069957443 10:72060693-72060715 GAGAGAGGACAGGAGAAAGAGGG + Exonic
1070260949 10:74855207-74855229 CAGTGAGGCCTGCAGGAAGGAGG + Intronic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1071675646 10:87653573-87653595 AAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071906408 10:90179297-90179319 CAGAGAGGTCAGAATGTGGAAGG + Intergenic
1071975100 10:90947694-90947716 AACACAGGCCTGAAGGAAGAGGG + Intergenic
1072275750 10:93821007-93821029 CGGTGAGGCTAGAAGCAAGATGG + Intergenic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1072799936 10:98385748-98385770 CACAGAGGCCAGGGGGAGGAAGG - Intronic
1073458901 10:103654213-103654235 AACAGAGTCCAGCAGGAAGAAGG - Intronic
1074171463 10:110942881-110942903 TATAGAGGCCAGAAGGCAGTGGG - Intronic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1074940587 10:118232743-118232765 CTCAGAGGACAGGAGGAAGAGGG + Intergenic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076334749 10:129698189-129698211 GAGAGAGACCAGAATGCAGAGGG + Intronic
1076480544 10:130782548-130782570 GAGAGAGGCCATAAGGGACAGGG + Intergenic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076524755 10:131105324-131105346 CAGAGAGGACAGCATGGAGAGGG - Intronic
1076530787 10:131142994-131143016 GAGAGAGGCAAGATGGACGAGGG + Intronic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077136710 11:1003213-1003235 AGGAGAGGCCAGAGGGGAGATGG + Intronic
1077194707 11:1273595-1273617 CAGAGAGGCCAGACCGGCGATGG + Intergenic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077236678 11:1485195-1485217 CAGCCAGGCCCTAAGGAAGACGG - Intronic
1077353871 11:2105721-2105743 CTGAGAGGCCAGCAGGACGAAGG + Intergenic
1077478891 11:2803724-2803746 CTGAGAGGCCAGGAGAAAGAAGG - Intronic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1077813081 11:5658335-5658357 TGAAGAGGCCAGAAGGAAGATGG - Intergenic
1078170129 11:8923492-8923514 TAGAGAGGGCATAAAGAAGATGG - Intronic
1078303680 11:10160449-10160471 AAGAGAGGAAAAAAGGAAGAAGG + Intronic
1078341835 11:10502663-10502685 CAGAGAGGGGAGAAGGGAAAAGG - Intronic
1078455149 11:11469195-11469217 CACAGAGGCAAGAAAGCAGACGG - Intronic
1078519438 11:12051415-12051437 CAGAGAGGCCATAAGGGATGTGG - Intergenic
1078550838 11:12279664-12279686 GAGAGAGGCAGGAAGGGAGAGGG - Intronic
1078654446 11:13225340-13225362 CAAAGAGACCAGAACTAAGAAGG + Intergenic
1078928830 11:15897807-15897829 CAGCAAGCCGAGAAGGAAGAGGG - Intergenic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079292427 11:19200442-19200464 AAGAGAGGAATGAAGGAAGAGGG - Intronic
1079424034 11:20323429-20323451 CAGAGAGGCAAAAAGGAAGAAGG - Intergenic
1079613029 11:22456844-22456866 CATGGAGGTTAGAAGGAAGATGG - Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1080451647 11:32383163-32383185 CAGGGAGGTCTGCAGGAAGAGGG - Intergenic
1080815468 11:35752296-35752318 AAGAGTGGCCAACAGGAAGAAGG - Intronic
1080928407 11:36782636-36782658 CAGAGAGGTGAGACAGAAGAGGG + Intergenic
1081602600 11:44505728-44505750 AAGAGAGGCCAGGAGGCAAAGGG - Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1082234205 11:49803132-49803154 CAGAAAGGATAGTAGGAAGATGG + Intergenic
1083030678 11:59589080-59589102 CATAGAGGCCAGAAGGCAGTGGG + Intronic
1083044591 11:59722319-59722341 CAAAGAGGAAAGAAGCAAGATGG - Intronic
1083193529 11:61069296-61069318 CTGAGGGGCCAGAAGAAAGGGGG - Intergenic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083836326 11:65270943-65270965 GAAAGAGGACAGAAGGAGGAGGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084136095 11:67183435-67183457 CAGAGAGGATTGTAGGAAGATGG + Intronic
1084400579 11:68940689-68940711 CAGAGAGGTCAGAAGGAGAGGGG - Intergenic
1084506055 11:69569243-69569265 CAGAGAGGACAAAACAAAGATGG + Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085308169 11:75500171-75500193 AGGAGAGGCCAGAGGGAGGAGGG - Intronic
1085446779 11:76606076-76606098 CCGAGAGGGCATAAGGCAGAGGG - Intergenic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1085526617 11:77167727-77167749 CAGGCAGGCAGGAAGGAAGAAGG - Intronic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1088106539 11:106212830-106212852 CAGAGAGGCTACAGGGAAGCAGG + Intergenic
1088450720 11:109978523-109978545 CAGAGAGCCCAGATTGTAGAAGG + Intergenic
1088460350 11:110075943-110075965 CTTAGAGGTCAGAAGCAAGATGG + Intergenic
1088529522 11:110793573-110793595 GAGAGAGTCAAGAAGGCAGAAGG - Intergenic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1089019220 11:115194829-115194851 CACACAGGGCAGAAGGAACAAGG + Intronic
1089336210 11:117725657-117725679 CAGAGAGGTCTGCAGGAGGAGGG + Intronic
1089363912 11:117909548-117909570 GAGAGAGGCAGGCAGGAAGAGGG - Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1090097545 11:123757747-123757769 CTGGGAGGCAAGAAAGAAGATGG - Intergenic
1090104792 11:123841270-123841292 CAGTGAGGTCAGGAGGATGAGGG + Intergenic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091230865 11:133987171-133987193 CAGGAAGGCAGGAAGGAAGAAGG + Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091575387 12:1728871-1728893 AAGAGAGTCAAGATGGAAGATGG - Intronic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1091799232 12:3314247-3314269 CAGAGAGGCCTGGAGCCAGAAGG - Intergenic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1092984968 12:13836673-13836695 CAAACAGGCCAGAAGGACTAGGG - Intronic
1093149188 12:15601698-15601720 GAGAGAGACAAGAAAGAAGAGGG - Intergenic
1093888091 12:24486546-24486568 AAGAGAGGCCAGAGGGGACAAGG - Intergenic
1094058976 12:26293410-26293432 AAGCAAGGCCAGAAGGAACAAGG + Intronic
1094741121 12:33290484-33290506 CTTAGAGGACAGAAGCAAGATGG - Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095190875 12:39256668-39256690 CAGAAATACCAGAATGAAGAGGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095974340 12:47929023-47929045 CAGCGTGGCCAGTAGGGAGAGGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096504359 12:52083173-52083195 CTCAGAGGCCAGAAGGCAGGGGG - Intergenic
1098205336 12:68103293-68103315 GAGAGAAGCAAGAAGGAATAAGG - Intergenic
1098214281 12:68199378-68199400 CAGAGAGACCTGAAGGAAATGGG + Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098460799 12:70731050-70731072 CAGAGAGGAAGGAAGGAGGAAGG + Intronic
1099892416 12:88606137-88606159 CCTAGAGGCCAGAAGAAAGTTGG + Intergenic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100426685 12:94494151-94494173 CCGTGAGGCTAGAAGCAAGATGG - Intergenic
1100515451 12:95323144-95323166 AAGAAAGGAAAGAAGGAAGAAGG + Intergenic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100964415 12:99997253-99997275 CAGAGATGCCATAAGGACTATGG + Intergenic
1101766807 12:107708560-107708582 CAGAGAGGGAAGAAGGGATAGGG - Intronic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1102574697 12:113849050-113849072 TGTAGAGGCCAAAAGGAAGAAGG - Intronic
1102765214 12:115426975-115426997 CAGTGAGGTCAGCAGCAAGAAGG + Intergenic
1103030179 12:117606521-117606543 CAGGGAGGCAGGAAGGAAGGAGG - Intronic
1103123826 12:118403734-118403756 CAGAGACACCAGAATGGAGAAGG - Intronic
1103147593 12:118609083-118609105 AAGAGAGGAAGGAAGGAAGAGGG + Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104301726 12:127570603-127570625 AAGAGAGGAAAGAAGGAGGAAGG + Intergenic
1104353454 12:128065059-128065081 GAGAAAGGACAGAAGAAAGACGG + Intergenic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104595172 12:130115801-130115823 CAGAGAGGCCAGGAGGAGCTTGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104820542 12:131675017-131675039 AGGAGAGGGGAGAAGGAAGATGG - Intergenic
1105284325 13:18992410-18992432 GCCAGAGGCCAGAAGGGAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284604 13:18994002-18994024 GCCAGAGGCCAAAAGGAAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284728 13:18994739-18994761 GAGGAAGGCCAGAAGAAAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105285075 13:18996759-18996781 GCCAGAGGCCAGAAGGCAGAAGG + Intergenic
1105917424 13:24929448-24929470 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1106001884 13:25731359-25731381 GAGAGAGGAAGGAAGGAAGAGGG + Intronic
1106139759 13:27002332-27002354 CTGAAAGGGCAGAAGGGAGATGG + Intergenic
1106810321 13:33352627-33352649 AAGAGAAGCCAGATGAAAGACGG + Intergenic
1107340222 13:39397581-39397603 CTGAGATGCCAGAGGAAAGAGGG - Intronic
1107377747 13:39822717-39822739 CAGAGAGGCAAGAACGAGGAAGG - Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1107508785 13:41061264-41061286 CAGCGAGCCTAGAAGGAGGATGG + Exonic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108204198 13:48071821-48071843 AAGAGAGGACAGGAGGAAAAAGG - Intronic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1108905915 13:55472717-55472739 CATACAGGCCAGGAGGGAGAGGG + Intergenic
1109172366 13:59112702-59112724 CAGAGAGCCCAGTACAAAGAAGG + Intergenic
1109370558 13:61415297-61415319 CAGAAAGGCAAGAGGGCAGAAGG + Exonic
1109814185 13:67557858-67557880 CATGGAGGCCAGAAGGTAGTTGG + Intergenic
1110552158 13:76822096-76822118 CAGATAGGCAGAAAGGAAGATGG - Intergenic
1110760427 13:79224817-79224839 GAGAGAGGACGGAAGGAAGAAGG + Intergenic
1110888051 13:80663580-80663602 CTTACAGGCCAGAAGGAAGTGGG - Intergenic
1111994539 13:95151505-95151527 CAAAGAGGAAAGAAGGAAGAAGG + Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112612884 13:100973355-100973377 CAGAGAGGCCAAAACGAATCTGG - Intergenic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1112953566 13:105032516-105032538 CAAAAAGGACAGAAGGTAGAAGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1113898483 13:113782531-113782553 CCGGTAGGCCAGAAGCAAGATGG - Intronic
1113933550 13:113981397-113981419 CAGAGAGGCTGGGAGGAAGCAGG + Intronic
1114270421 14:21097646-21097668 AAGATAAGCCAGAAGGATGATGG + Intronic
1114349959 14:21838850-21838872 CATAGAAGCCAGAAGGCAGTGGG + Intergenic
1114787264 14:25615309-25615331 GAGAGAGGAAAAAAGGAAGAAGG - Intergenic
1115178127 14:30589404-30589426 CAGAGAGGCAAAGAAGAAGAAGG + Exonic
1115724307 14:36196050-36196072 CAGAGAGGCCAGCAAGAACAAGG - Intergenic
1115791155 14:36880056-36880078 CTGAGTGGCCAGGAAGAAGAGGG - Intronic
1115820837 14:37211026-37211048 CTGAGAAGCTAGAAGCAAGATGG + Intronic
1116268230 14:42724520-42724542 GAGAGAAGCCAGTAGGAAGAAGG - Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117070642 14:52052936-52052958 CTGAGAGGCGAGGAGGGAGATGG - Intronic
1117160601 14:52985836-52985858 CAGAGAGGTGAGAAGAAAGCAGG + Intergenic
1117490887 14:56246490-56246512 CGGAGAGGCCAGAAAGGAGAAGG - Intronic
1118391891 14:65302897-65302919 CAGAGAGACAAGAATAAAGAGGG + Intergenic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119147963 14:72333502-72333524 TGGAGAGGACAGAAAGAAGAGGG - Intronic
1119257953 14:73215765-73215787 CAGAGTGGCTAGAATGAAAAAGG + Intronic
1119347823 14:73940939-73940961 CACAGATGCCACCAGGAAGAGGG - Exonic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119510543 14:75207772-75207794 AAGAGAGCCAAGAAGGATGAAGG + Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1119957398 14:78813852-78813874 AAGTGAAGCCAAAAGGAAGAAGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120285962 14:82501915-82501937 CAGAGAGATCAGAAAGAATATGG - Intergenic
1120461655 14:84805094-84805116 TGGAGAGGCCAAAAGGAAGCAGG + Intergenic
1120545919 14:85811258-85811280 CAAAGAGGCCAGAGTGAATAAGG + Intergenic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121624595 14:95374916-95374938 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624604 14:95374946-95374968 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624618 14:95374985-95375007 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624626 14:95375019-95375041 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624635 14:95375049-95375071 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624649 14:95375088-95375110 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624656 14:95375122-95375144 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624678 14:95375202-95375224 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624688 14:95375237-95375259 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624704 14:95375292-95375314 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624716 14:95375327-95375349 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121682591 14:95806143-95806165 CAAAGAGGCCAGAAGGCAGTGGG - Intergenic
1121697983 14:95928426-95928448 CAGAGAGGGAGGGAGGAAGAAGG - Intergenic
1121814702 14:96920382-96920404 CAGTGAGGCCACCAGCAAGAGGG + Intronic
1121952168 14:98181022-98181044 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1122036274 14:98951330-98951352 CAGAGAGGCCAGGAGGGAAATGG + Intergenic
1122198771 14:100109227-100109249 CAGGGAGGACAGACTGAAGAAGG - Intronic
1122295086 14:100700941-100700963 CCTAGTGGCCAGCAGGAAGAGGG + Intergenic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1124231080 15:27946968-27946990 CAGAGAGGCCAGGAGGACCCTGG + Intronic
1124245204 15:28064117-28064139 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124501608 15:30232348-30232370 AAGAGAGGAAGGAAGGAAGAAGG - Intergenic
1124630414 15:31333609-31333631 GAGAGAGGCGAGATGGAAAAGGG - Intronic
1124741958 15:32306315-32306337 AAGAGAGGAAGGAAGGAAGAAGG + Intergenic
1124829267 15:33132179-33132201 CAGCCAGGAAAGAAGGAAGAGGG - Intronic
1125256956 15:37775724-37775746 AGGAAAGGCCAGAAGAAAGAAGG - Intergenic
1125478696 15:40065040-40065062 CAGAGATGGGAAAAGGAAGAAGG + Intergenic
1126122706 15:45267901-45267923 GAGATAGGCAAGAAGGAATATGG - Intronic
1126577251 15:50209350-50209372 GAGGGAGGCCAAAAGAAAGAGGG + Intronic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1127188129 15:56501398-56501420 CATAGAGGCCAGTAAGAAGAGGG + Intergenic
1127291268 15:57573607-57573629 AAGCGAGGACAGAAGGAAGTAGG + Intergenic
1127429396 15:58887372-58887394 CAGACAGGCGAGAAGTACGAGGG - Exonic
1128229664 15:66025682-66025704 CCGAGAGGCCTGAAGGCAAAAGG - Intronic
1128239164 15:66089246-66089268 CAGAGAGGCCTGAGTGATGAAGG - Intronic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1128506341 15:68275667-68275689 TAGAGAGGGCACGAGGAAGAAGG + Intergenic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128737397 15:70060923-70060945 CCCACAGGCCAGAAGGCAGACGG - Intronic
1129155292 15:73713792-73713814 CAAAGAGGTGAGAAGGCAGAGGG - Exonic
1129210440 15:74064994-74065016 AAGAGAGGCTGGAAGGAAAAGGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1130110396 15:80959254-80959276 CAGAGATGACCGAAGGTAGATGG + Intronic
1130533285 15:84764201-84764223 CAGAGAGGACAGAAAGACAAGGG - Intronic
1130804682 15:87307297-87307319 CAAAGAAGCAAGAAGGAAAAGGG - Intergenic
1130888840 15:88116056-88116078 CAGAGAGGCTAGCAGGCAGTGGG - Intronic
1130928964 15:88407246-88407268 CATAGAGGCCAGAAGATAGTGGG - Intergenic
1131332506 15:91514883-91514905 AGGAGAGGCTACAAGGAAGACGG + Intergenic
1131858828 15:96629437-96629459 ATAAGTGGCCAGAAGGAAGAAGG - Intergenic
1131913154 15:97231504-97231526 AAGAGAGGAAAGAAGGAAGGAGG + Intergenic
1132094557 15:98972453-98972475 AAGAGAGGAAAAAAGGAAGAAGG + Intronic
1132209744 15:100011255-100011277 CAGAAAGGAAGGAAGGAAGAAGG + Intronic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133422117 16:5654775-5654797 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1134122742 16:11596544-11596566 CAGAGAGGGGAGGAGGCAGAGGG + Intronic
1134222155 16:12363234-12363256 CAGCCAGGGCAGAAGAAAGAAGG + Intronic
1135613414 16:23888457-23888479 CAGAAAGGCAGCAAGGAAGATGG - Intronic
1135807201 16:25553683-25553705 CAGAGAGGGGACATGGAAGAAGG + Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136285545 16:29238386-29238408 GAGAGAGGGAAGAAGGAAGGAGG + Intergenic
1137446292 16:48534612-48534634 CACAGGGACCACAAGGAAGATGG - Intergenic
1137487986 16:48907558-48907580 AAGAGAGGCCCAAAGGAAGCTGG + Intergenic
1137683805 16:50372374-50372396 CAGAGAGGCCAGGCTGAAGAGGG - Intergenic
1137847160 16:51701990-51702012 AAGAGAGGAAAGAAGAAAGAAGG + Intergenic
1138172243 16:54863512-54863534 AAGAGAGACGAAAAGGAAGAGGG + Intergenic
1138179154 16:54930707-54930729 GAGAGAGCCGAGGAGGAAGAGGG + Intergenic
1138215505 16:55201554-55201576 AAGAGAGGGAGGAAGGAAGAAGG - Intergenic
1138680051 16:58677794-58677816 AAGAGATGCCAGAGGTAAGAGGG + Intronic
1138860507 16:60750222-60750244 CTGCGAGGCTAGAAGCAAGATGG + Intergenic
1139684632 16:68593408-68593430 CAGAGAGGGCAGAAGGCTGGCGG + Intergenic
1139986986 16:70906788-70906810 AGGAGAGGGCAGAAGGATGAGGG - Intronic
1140177114 16:72673404-72673426 TATGGAGGCCAGAAGGAAGTGGG + Intergenic
1140196389 16:72859045-72859067 CACAGAAGCCAGAGGGCAGAGGG - Intronic
1140569466 16:76086602-76086624 CAGAGAGGCTAGAAAGCAAATGG - Intergenic
1140857477 16:78990687-78990709 CATAGAGGAAAGAAGGAAGAAGG + Intronic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1142090874 16:88208528-88208550 GAGAGAGGGAAGAAGGAAGGAGG + Intergenic
1142109433 16:88323414-88323436 CAGAGAAGTGGGAAGGAAGAAGG - Intergenic
1142302520 16:89266809-89266831 CAGACAGCTCAGAAGGAAAAGGG + Intergenic
1142346594 16:89557978-89558000 CAGGGAGGGCAGAAGCAAGGGGG - Intergenic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142927834 17:3256724-3256746 CTGAGAGGCGAGCAGGGAGATGG - Intergenic
1143542949 17:7580380-7580402 CTCAGAGGGAAGAAGGAAGAGGG + Intronic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143770455 17:9165217-9165239 CAGAGAGGCAAGAAGGGGCAGGG + Intronic
1143804638 17:9416281-9416303 CTGAGAGGCTAGAAGCAGGATGG - Intronic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1145350640 17:22079367-22079389 CAGAGAGTAAAGAAGGACGAAGG - Intergenic
1145826363 17:27879993-27880015 GAGAGGGGGCAGCAGGAAGAAGG - Intronic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146502142 17:33373314-33373336 CTTAGAGGTCAGAAGCAAGATGG - Intronic
1146515724 17:33487715-33487737 CAGCGTGGCCAGAATAAAGAAGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146660252 17:34660781-34660803 AAGAGAAGCCAGAAGGAATGGGG + Intergenic
1146906842 17:36623531-36623553 GAGAGAGGGTAGAAGGAAGGAGG - Intergenic
1146952417 17:36916160-36916182 CAGAAAGGCCACATGGATGAAGG - Intergenic
1147387432 17:40090635-40090657 GAGAGAGCCCAGAAGACAGATGG - Intronic
1147418633 17:40311085-40311107 CAGGGATGGCAGAAGGAAGGTGG - Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147590528 17:41680282-41680304 CAGGCAGCCCAGCAGGAAGAGGG + Intergenic
1147842697 17:43383260-43383282 CAGAAAGGCCTGAAGGGAGATGG + Intergenic
1147844114 17:43392952-43392974 CTGAGAGGCCAGAGGGAATTCGG - Intergenic
1147945131 17:44076462-44076484 CAGAGAGGCAGGAAAGGAGAGGG + Intergenic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1148477829 17:47940984-47941006 CGGTGAGGTGAGAAGGAAGATGG - Intergenic
1148509027 17:48153280-48153302 AAGAGAGGACAAAAGGGAGAGGG - Intronic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1148677296 17:49452735-49452757 CAGAGAGGCCAAGAGGATGCTGG - Intronic
1148677509 17:49453741-49453763 CAGAGAGGCCAAGAGGATGCTGG - Intronic
1148845881 17:50529525-50529547 GGGAGGGGCCAGAAGGGAGAGGG + Intronic
1149095832 17:52839485-52839507 CAAAGATGTCAGAAGGAAAAAGG - Intergenic
1149114081 17:53070629-53070651 CAGAGACTGCAGAAGGAAAATGG - Intergenic
1149307623 17:55364302-55364324 AAGAGAGGGCAGAAGGACAAAGG + Intergenic
1149982655 17:61323658-61323680 CAGAGATGCCATATGGAGGAAGG - Intronic
1150124944 17:62629423-62629445 CACAGAGACCAGGAGGAGGAGGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150550706 17:66207227-66207249 CTGAGAGGTGAGAAGAAAGATGG + Intergenic
1150711172 17:67531987-67532009 CAGAGAGGCAGGAAGGCAGATGG + Intronic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151450145 17:74193813-74193835 CAGAAAGGTAAGAAGGAAGTGGG + Intergenic
1151715185 17:75827605-75827627 CAGGAAGGCCAGGAGGCAGATGG + Exonic
1151860408 17:76756895-76756917 CACAGAGGCCAGAGGGGAAAAGG + Intronic
1152003220 17:77660302-77660324 GAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1152253464 17:79223897-79223919 CAGAGGGGCCAAGAGGAACAAGG + Intronic
1152472836 17:80499931-80499953 CAAAGAGGCCAGAGGGAGGGGGG + Intergenic
1152723436 17:81933957-81933979 CAGCGAGGGCAGGAGGAAGGTGG + Intronic
1152890554 17:82879322-82879344 AAGGGAGGCCAGGAGGAAGCTGG - Intronic
1153181188 18:2435602-2435624 CAGAGAGGCAAGGAGGACCAGGG - Intergenic
1153187461 18:2501070-2501092 CAGATATGCCACAAGGAAAAAGG - Intergenic
1153196133 18:2598508-2598530 AACAGAGCCCTGAAGGAAGAAGG + Intronic
1153345436 18:4020617-4020639 CTGAGAGGTTAGAAGCAAGATGG - Intronic
1153372276 18:4332798-4332820 CTGAGAGGTCAGAAGGAAAATGG - Intronic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153885263 18:9458792-9458814 GAGAAAGGAAAGAAGGAAGAAGG + Intergenic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1153993347 18:10419172-10419194 AAGTGAGGCAAGAAGGAAAAGGG - Intergenic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1154982808 18:21517807-21517829 CAGCGAGGGCAGAAGAAAGCAGG - Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1155533648 18:26793927-26793949 CAGAAAGGCAGGAAGGCAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155707489 18:28835277-28835299 GAGAGAGGCCTGTAGGAACAAGG - Intergenic
1155776937 18:29776556-29776578 TGGAGATGCCAGAAGGGAGAAGG - Intergenic
1155868184 18:30992581-30992603 AGGAGAGGCCACAAGGAATATGG - Exonic
1156128410 18:33936893-33936915 CAAAGAGGCAAAAAGTAAGAGGG - Intronic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1157523190 18:48359505-48359527 CAGACAGGCCAGATGTACGAAGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157790736 18:50528822-50528844 AAAAGAGGCGAGAAGTAAGAGGG - Intergenic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1158102958 18:53851401-53851423 CAGAGATGAGAGATGGAAGAAGG - Intergenic
1158103827 18:53861495-53861517 AAGGGAGGGCAGAAGGAAGGAGG + Intergenic
1158318510 18:56237979-56238001 CAGACAGGCCCCAGGGAAGAAGG + Intergenic
1158396976 18:57087052-57087074 CTGAGAGGATAGAAGCAAGATGG - Intergenic
1158618904 18:59013208-59013230 GAAAGAGGGCAGAAGGCAGAGGG - Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159268190 18:66111654-66111676 GAGAGAGGAAGGAAGGAAGAAGG + Intergenic
1159420187 18:68208452-68208474 CAGAGAGGGATCAAGGAAGATGG + Intergenic
1159740374 18:72160622-72160644 CAGAGAGCCCTGATGGATGAGGG + Intergenic
1159938352 18:74386459-74386481 CAGAGAGGCCAGACGGGAGGTGG + Intergenic
1160556032 18:79725843-79725865 CACGGAGCCCAGAAGGAAGCCGG - Intronic
1160721043 19:597014-597036 GCCAGAGGTCAGAAGGAAGAAGG - Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161138557 19:2634974-2634996 CAGTGAGGCAAGAAGCAAAAAGG + Intronic
1161157175 19:2738575-2738597 CAGAGAAGCAAGAAAGAAGAAGG - Intronic
1161303255 19:3553208-3553230 CAGACTGGCCAGCAGGAACAGGG - Intronic
1161957039 19:7501871-7501893 GAGAGAGGAAGGAAGGAAGAAGG + Intronic
1162015548 19:7844823-7844845 CACAGAGGCCTGGAGAAAGAGGG + Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162071003 19:8151963-8151985 AAGAGAGGGGAGAAGGAAGCCGG + Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162265870 19:9573820-9573842 CACACAGGCCAGAAGGGAGTAGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165421364 19:35723652-35723674 GAGAGAAGCCAGAAAGAAGCGGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167110465 19:47457634-47457656 CAGAGAGGCGGGGAGGGAGAAGG - Intronic
1167214240 19:48153881-48153903 CAGAGAAGCCAAGAGGAAGAAGG - Exonic
1167280788 19:48567131-48567153 AAGAGAGGCCAGAAACAACAGGG - Intronic
1167528918 19:50002701-50002723 AAGGGAGGCCAGAAGGGAAAAGG + Intronic
1167674909 19:50877935-50877957 CACTGAGGCCAGATGGAGGATGG - Intronic
1167674950 19:50878115-50878137 CAGACAGGTCAGCAGGATGAGGG - Intronic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
1202697455 1_KI270712v1_random:135398-135420 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
925198282 2:1945413-1945435 GAGAGAGGCCAGGAGGACCAAGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925304888 2:2841018-2841040 CAGAGAAGGCATATGGAAGAGGG + Intergenic
925387234 2:3470424-3470446 CAGAGAGTCCAGCAGGAACAGGG - Intronic
925438840 2:3866727-3866749 CTTAGAGGTCAGAAGCAAGATGG - Intergenic
925529111 2:4839941-4839963 CAGAGGGGCAAGAAGGACAAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926446276 2:12946556-12946578 CTCAAAGGCCAGAAGCAAGAAGG - Intergenic
926659898 2:15453191-15453213 CAGAGAGCACAAAAGGAACAAGG + Intronic
926663717 2:15496661-15496683 GAGAGAGGGAGGAAGGAAGAAGG + Intronic
926800755 2:16658376-16658398 AGGTCAGGCCAGAAGGAAGATGG + Intronic
927062359 2:19435773-19435795 CACAAAGGCCAGCAGGAAGTTGG + Intergenic
927876819 2:26662334-26662356 AAGAGAGTCCAGAAGAAAAATGG - Intergenic
928308576 2:30191505-30191527 GAGAGATGCCAGCAGGAAAAAGG + Intergenic
929057354 2:37889895-37889917 CAGATAGCCCAGAAGGAAAATGG - Intergenic
929177637 2:38997635-38997657 CATGGAGGCCAGAAGGCAGTGGG + Intronic
929240646 2:39649998-39650020 AAGAGACTCCAGAAGGAATATGG - Intergenic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929885746 2:45876301-45876323 CAGAGAAGCCAGATGACAGAGGG - Intronic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
929930995 2:46255367-46255389 AAGAGAGGCCACAGAGAAGAAGG - Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930153030 2:48077705-48077727 TACAGAGGCCTGGAGGAAGAGGG - Intergenic
930164442 2:48190368-48190390 CTGAGAGGCTAGAAGCAGGATGG + Intergenic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
930990933 2:57653617-57653639 CATAGAGACCAGAAGGTAGTGGG - Intergenic
931229881 2:60365324-60365346 TGGAGAGGCCTTAAGGAAGAGGG + Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931443190 2:62305629-62305651 CACAGAGGCCAGACGGGACAGGG + Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
931982287 2:67706902-67706924 CAGAGAGGGAAGAAGAAAGCAGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932221169 2:70000026-70000048 CAGGGAGGCCAGCAGGGAGGCGG - Intergenic
932486823 2:72089233-72089255 AAGAGAGGGAGGAAGGAAGATGG + Intergenic
932605455 2:73162875-73162897 CAGAGAGGGAAGAAGGGAAATGG + Intergenic
932706672 2:74031318-74031340 CAGACAGGCCAGAGAGACGAGGG + Intronic
932863177 2:75315812-75315834 AAGAGAGGCCATATGGAAAATGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933471845 2:82735833-82735855 CGGAGAGGCCAGTAGACAGACGG + Intergenic
933571859 2:84023278-84023300 CAGTGAGGCCAGGTGCAAGAAGG + Intergenic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
933779463 2:85791486-85791508 CGGAGAGGCTTGAAGGGAGAGGG + Intergenic
933855833 2:86413307-86413329 CACAGATGCCAAAAAGAAGATGG + Intergenic
934278625 2:91592422-91592444 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
934603352 2:95675804-95675826 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
934603689 2:95678497-95678519 AAGAAAGGCTGGAAGGAAGATGG - Intergenic
934708266 2:96499671-96499693 AAGAGGGGCCTGAAGGAAGGTGG - Intronic
936015852 2:108958555-108958577 TAGAGAGGGCAGAAGGACGGTGG + Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
936472522 2:112811685-112811707 CAGGGAGGCCACAAGGCTGATGG + Intergenic
936536734 2:113318030-113318052 AAGAAGGGCCGGAAGGAAGATGG - Intergenic
936674841 2:114702862-114702884 AAGATAGTCCAGAAAGAAGATGG + Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937152324 2:119694583-119694605 CAAAGGGGCCAGGAGGAGGATGG - Intergenic
937248551 2:120509661-120509683 CAGAAGGGCCAGAAGATAGATGG + Intergenic
937257961 2:120568197-120568219 CAGAGAAGCCAGAGGGGAGGTGG - Intergenic
937861413 2:126714403-126714425 CAGAAAGGCCACAAGAAACAGGG + Intergenic
937921071 2:127131296-127131318 CACAGATGGCAGAAGGCAGAAGG - Intergenic
938015483 2:127863695-127863717 GAGAGTGGCCAGTTGGAAGAAGG - Exonic
938068622 2:128294903-128294925 CAGAGAGGCTCCAAGGAACAAGG + Intronic
938121449 2:128636984-128637006 GGGAGAGGCCAGGAGCAAGAGGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938204596 2:129408719-129408741 CAGAGAGGCCAGATGACAGTGGG - Intergenic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938264339 2:129915685-129915707 CAGAGAGGCCTGGTGGTAGATGG - Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
939436214 2:142181055-142181077 TGGGGAGGCCAGAAGGAGGATGG - Intergenic
939513624 2:143139006-143139028 AAGAGAGACCAAAAAGAAGATGG - Intronic
940075149 2:149732977-149732999 CTCAGAGGTCAGAAGCAAGATGG + Intergenic
940846906 2:158651608-158651630 GACAGAGGCCAGAAAGAAGCAGG - Intronic
940894348 2:159065950-159065972 AAGGGAGGCAAGAAGGAAGCAGG + Exonic
940968334 2:159865780-159865802 CAGATTGGCCAAGAGGAAGAAGG + Intronic
941039139 2:160600665-160600687 CAGAGTGGCTAGAAGAAAGCAGG + Intergenic
941195719 2:162449047-162449069 CAGAGGGGACAGAATGAACAAGG + Intronic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
942057009 2:172193447-172193469 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
942462718 2:176179373-176179395 GAGAGAAGGCTGAAGGAAGAGGG - Intergenic
943090753 2:183372036-183372058 CAAAGAGGAGAGAAGGAAGATGG + Intergenic
943521932 2:188962304-188962326 CAGGCAGGCAAGAAGGAAGGAGG + Intergenic
943798181 2:192024971-192024993 CAGAGAGGCCCGAACAAAGAGGG + Intronic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944145494 2:196503351-196503373 CAGAGGGGCAAGATAGAAGAGGG + Intronic
944536316 2:200713803-200713825 CAGAGAGGACCAAAGGAGGAAGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
944891387 2:204120643-204120665 AAGAGAAGCAAGAAGGGAGAAGG - Intergenic
945028000 2:205637640-205637662 CAGAGAGGGGAGAAGCCAGAAGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945658847 2:212659469-212659491 GAGAGGGGCCAGAAGACAGAAGG + Intergenic
946054553 2:216889411-216889433 GAGAGAGGCCAGAAGCCAGCAGG + Intergenic
946153150 2:217789673-217789695 CAGAGAGGAGGGAAGGCAGAGGG + Intergenic
946161989 2:217841067-217841089 GACAGAGGAGAGAAGGAAGAAGG + Intronic
946537951 2:220651746-220651768 CTGAGAGGGAAGAAGGAAGCCGG + Intergenic
946861231 2:224001862-224001884 CACAGAGGCCAAGAGGAAGAGGG + Exonic
946987840 2:225292886-225292908 AAGACAGGAGAGAAGGAAGAAGG - Intergenic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947082559 2:226414982-226415004 AAGAAAGGACAAAAGGAAGAAGG + Intergenic
947241030 2:227994868-227994890 CACAGAGGCCAAATGGAAAATGG - Intronic
947243627 2:228022294-228022316 AAGAGAGGCCAGAATTAAGTTGG + Intronic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947828750 2:233124472-233124494 CAGGGAGGCCAAAAGGGACAGGG - Intronic
948044695 2:234934760-234934782 CAGAGAGTCCAGAATGGAGACGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
948911254 2:241003913-241003935 CAGAGATGTTAGAAGGCAGAGGG - Intronic
949072292 2:242033029-242033051 GAGAGAGGGCAGAGGGTAGACGG + Intergenic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1169507894 20:6232967-6232989 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
1169772978 20:9221518-9221540 GAGTGAGGCAAGGAGGAAGATGG - Intronic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170939101 20:20833818-20833840 TAGACGGGCCAGCAGGAAGAGGG + Intergenic
1171241787 20:23575233-23575255 CATACAGGCCAGGAGGAAGTGGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1171782703 20:29435510-29435532 TAGAGATGGCAGAAGGATGAGGG + Intergenic
1172358316 20:34294946-34294968 CAGAGAGTCAAGAAGCAAGCTGG - Intronic
1172748727 20:37234216-37234238 CTAAAAGGCCAGGAGGAAGAGGG - Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172790636 20:37503067-37503089 CAGAGAGGTCAGGAGGACCAGGG - Intronic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1172882941 20:38213429-38213451 CAGCGCGCCCAGAACGAAGAGGG - Exonic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173657725 20:44711894-44711916 CTCTGAGGCAAGAAGGAAGACGG - Intergenic
1173873899 20:46357834-46357856 CAGAGGGGCGAAGAGGAAGAGGG - Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174316781 20:49709302-49709324 CATAAAGGCCAGAGGGTAGAGGG + Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174862612 20:54105347-54105369 CCCAGAGGCCAGTGGGAAGATGG - Intergenic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175882756 20:62270336-62270358 CAGAGAGGCCAGGAGGGACAAGG - Intronic
1175882810 20:62270541-62270563 CAGAGAGGCCAGGAGGGACAAGG - Intronic
1175954316 20:62600767-62600789 CAGGTAGGCCAGGAGGCAGAGGG + Intergenic
1175978431 20:62725264-62725286 CAGGGAGGCCAGAATGATGCTGG - Intronic
1176009705 20:62886299-62886321 CTGAAAGGCCAGAAGGCAAATGG + Intronic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1176293372 21:5058129-5058151 CAGAAAACCCAGAAGGGAGATGG + Intergenic
1176385266 21:6135881-6135903 CAGCGAGGGAAGGAGGAAGATGG - Intergenic
1176546506 21:8204488-8204510 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176554400 21:8248679-8248701 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176565457 21:8387535-8387557 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176573322 21:8431703-8431725 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176892808 21:14338909-14338931 CAGAGAGACTAGAATGAAGCAGG + Intergenic
1177269789 21:18832644-18832666 GCCAGAGGCCAGAAGGAAGTTGG - Intergenic
1178150993 21:29793494-29793516 CAGAGAGGGGAAAAGGAAAAGGG - Intronic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1178724021 21:35035395-35035417 CAGAGAGGCCAGATGGGAGTGGG + Intronic
1178809184 21:35865788-35865810 CTGAGGGGCCAGGAGTAAGAGGG + Intronic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179033119 21:37737242-37737264 CAGAGTGGCCAGAAGTAAACTGG + Intronic
1179053191 21:37906818-37906840 AAGAGAGGGCAGAAAGAGGACGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179353541 21:40636394-40636416 AAGAGAGGGAAGAAGGAAGGGGG + Intronic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179738207 21:43402371-43402393 CAGCGAGGGAAGGAGGAAGATGG + Intergenic
1179863888 21:44205519-44205541 CAGAAAACCCAGAAGGGAGATGG - Intergenic
1180046351 21:45307550-45307572 CAGAGAGGACGAGAGGAAGACGG + Intergenic
1180079494 21:45480308-45480330 CAGAGAAGCCTGAAGGCAGGTGG - Intronic
1180869389 22:19137807-19137829 CACAGAGGCCAGAGTGCAGAGGG + Intronic
1180979355 22:19871516-19871538 CAGAGAGCCCAGCTCGAAGATGG + Intergenic
1181790133 22:25258896-25258918 CAGAGAGGCAAGTATGGAGATGG + Intergenic
1181825951 22:25515918-25515940 CAGAGAGGCAAGTATGGAGATGG + Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182048981 22:27298913-27298935 GGGAGAGGCAAGGAGGAAGATGG + Intergenic
1182077661 22:27505922-27505944 CACAGAGGCCAGAAATGAGAAGG + Intergenic
1182737643 22:32542273-32542295 CAGAGGGGCCATTAGGAAGAAGG + Intronic
1182737799 22:32543457-32543479 CAGAGAGCCAAGAAGAGAGATGG - Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184109276 22:42385474-42385496 CACATAGGGCAGAAGGCAGAGGG - Intronic
1184461243 22:44639451-44639473 CAGAGATGCCACATGGAAGGAGG + Intergenic
1184468457 22:44682464-44682486 CAGAGAGGCCAGCGGGGACATGG - Intronic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184846208 22:47089063-47089085 CAGAGAAGCAAGAAAGAGGAGGG + Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1184978820 22:48081706-48081728 GAAAGATCCCAGAAGGAAGAAGG + Intergenic
1185295276 22:50049950-50049972 CAGGGAGGCCAGGAGGGTGATGG + Intronic
1203251369 22_KI270733v1_random:120750-120772 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1203259415 22_KI270733v1_random:165824-165846 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
949301026 3:2584308-2584330 CAGAAAGGCCAGAAGGCATGCGG - Intronic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
949858076 3:8480393-8480415 CAGTGAAGCCACAAGGCAGAGGG - Intergenic
949900270 3:8808531-8808553 CACAAAAGCTAGAAGGAAGAAGG + Intronic
950143849 3:10634032-10634054 CAGAAAGGCGGCAAGGAAGAAGG - Intronic
950336156 3:12195050-12195072 CACAGAGGCCAGGAGGCAAAGGG + Intergenic
951445948 3:22781003-22781025 CAGAGAGGCCAGAAACTGGAAGG + Intergenic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952710055 3:36421107-36421129 CAGAGAGGAAAAAAGGAAGGAGG - Intronic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952942555 3:38455041-38455063 CCTGGAGGCCCGAAGGAAGAGGG - Intronic
953118504 3:40016119-40016141 AGAAGAGGACAGAAGGAAGAAGG - Intronic
953549116 3:43886747-43886769 CAGAAAGGGCAGAAGGCAAAGGG + Intergenic
953668017 3:44940012-44940034 CACAGAGGCCAGAAGGGTGCTGG + Intronic
954889081 3:53906631-53906653 CACGGAGGCCAGAAGGCAGTGGG + Intergenic
954895904 3:53974542-53974564 AAGAGAGGCCAGATGGGAGGGGG - Intergenic
954998489 3:54904111-54904133 GACAGAGGGCAGAAGGTAGAAGG + Intronic
955195413 3:56801368-56801390 CTGAGAGTCCAGACAGAAGATGG + Intronic
955491512 3:59487815-59487837 CAGAGTGGCCAGGAGTCAGAGGG - Intergenic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956626620 3:71273120-71273142 CACAAGGACCAGAAGGAAGAAGG - Intronic
956863249 3:73345425-73345447 CACAGTGGGCAGAAGGAACAGGG + Intergenic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
958501086 3:94909923-94909945 CAGAGAGGCCAAGAGGAATCTGG + Intergenic
959543814 3:107570816-107570838 CAGACAGGAGAGAAAGAAGAAGG + Intronic
959615523 3:108342928-108342950 CAGAGATGCAGGCAGGAAGAAGG - Intronic
960251593 3:115461443-115461465 CAGAGAGGCCAGGAAGAATCAGG + Intergenic
960346402 3:116538741-116538763 CAGAGAGGCCAGAAGAGAGACGG - Intronic
960463541 3:117967178-117967200 CAGTGAGGCTAGAACGAAGCTGG + Intergenic
960476163 3:118131295-118131317 CAGAGAAGCCATAAGAAACAGGG - Intergenic
960791031 3:121431154-121431176 CAGAGATGGCAGCAGTAAGAGGG - Intergenic
961192092 3:124970527-124970549 CTGAGTGGCAAGCAGGAAGAGGG - Exonic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
962825864 3:139100670-139100692 CAGAGAGGCCAGAGGGGTCAGGG - Intronic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
963113607 3:141707231-141707253 CAGAGAAGCCAGAATGGAAATGG - Intergenic
963248171 3:143082119-143082141 AGGAGAGGGAAGAAGGAAGAAGG - Intergenic
963323608 3:143836610-143836632 GAGAGGGGACAGAAGGAAGGAGG + Intronic
964423287 3:156527654-156527676 CTGAGAGGACAGGAGGAAAAGGG - Intronic
964485747 3:157183820-157183842 ATGAGAGGTCAGAAGAAAGAAGG - Intergenic
964672083 3:159238016-159238038 AGGAGAAGCCACAAGGAAGAAGG + Intronic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
965881583 3:173395139-173395161 CAGAGAGGCTAGTGGGAAGCGGG + Intergenic
966398554 3:179525081-179525103 CAGACAGGAGAGAAAGAAGAAGG + Intergenic
966543746 3:181120624-181120646 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
966869422 3:184280464-184280486 CAGAGAGGTCAGCAGGCAGCTGG + Intronic
966883988 3:184364795-184364817 CAGATATGCAAGAAGGAAAAGGG - Intronic
967277369 3:187789893-187789915 AAGAGAGGAAGGAAGGAAGAGGG + Intergenic
967309779 3:188095098-188095120 AAGACAGGCTAGAAGCAAGATGG - Intergenic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
968491686 4:893598-893620 CAGTGACGTCAGAAGCAAGAAGG + Intronic
968937213 4:3617538-3617560 GGGAGGGGCAAGAAGGAAGAAGG - Intergenic
969202393 4:5616300-5616322 CAGAAAGGGCTGAAGGAAGAGGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969373238 4:6747280-6747302 GAGAGAGGCGAGAGGGAAGAAGG - Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969723645 4:8906869-8906891 GAGGGAGGCAAGAAGGAAGGGGG - Intergenic
970219660 4:13797693-13797715 CAGGAAGGCCAGAATTAAGATGG + Intergenic
970231453 4:13915455-13915477 CAGAGAGGACAAAAGGGAGGTGG - Intergenic
971100374 4:23459539-23459561 CAGACAGGCAGGAAGGAACAAGG - Intergenic
971947352 4:33298481-33298503 CCAAGAGGCCGGAAGAAAGAAGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
972501093 4:39678606-39678628 ACCAGAGGCCAGAAGGAAGATGG - Intergenic
972711405 4:41599296-41599318 CAGAGAGGCAAGAAAGAAATAGG + Intronic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
972902974 4:43708022-43708044 GGAAGAGGACAGAAGGAAGAAGG + Intergenic
973093465 4:46166850-46166872 CTGAGAGGTCAGTAGAAAGAAGG - Intergenic
973547471 4:51996038-51996060 CAGAGAGGCCCCAGGGAGGAAGG - Exonic
973555794 4:52081418-52081440 CCCTGAGGCCAGAAGGAGGAGGG - Intronic
973565206 4:52179165-52179187 CACAGAGGCCAGAAAGCAGTGGG + Intergenic
973755974 4:54073755-54073777 CAGCAAGGCTAGAAGAAAGAGGG + Intronic
973936297 4:55850217-55850239 TGGAGAAGCCAGAAGGCAGATGG + Intergenic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
974691708 4:65305450-65305472 GAGAGAGACAAGAAGAAAGAGGG - Intergenic
974778171 4:66515430-66515452 GGGAGAGGGAAGAAGGAAGAGGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975151963 4:71032762-71032784 CAGACAGGAGAGAAAGAAGAAGG - Intergenic
975152019 4:71033076-71033098 CAGACAGGAGAGAAAGAAGAAGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975639714 4:76487875-76487897 CAAAAAGGCCAAAAGAAAGAAGG - Intronic
975642938 4:76518464-76518486 CAGACAGGCAAAAAGGAAGGAGG - Intronic
975785370 4:77881869-77881891 GAGAGAGACCTGAAGGAAGTAGG - Intronic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
976143238 4:82015131-82015153 TAAAGAAGCAAGAAGGAAGAAGG + Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
976473179 4:85453365-85453387 CAGACAGTCAAGAAGGTAGAAGG - Intergenic
976648790 4:87413193-87413215 AAGAGAGGAGAGTAGGAAGAGGG + Intergenic
976686772 4:87822614-87822636 CAGAGAGGCCAGATGACAGATGG + Intronic
976960538 4:90966413-90966435 CAGGGAGGCCAGAAGAAAGTGGG + Intronic
977153309 4:93541870-93541892 AAGAGAGGCCAGAATGATGAGGG - Intronic
977297050 4:95222218-95222240 CAGAGAACCCAGAATGAATATGG - Intronic
977437993 4:97024880-97024902 AAGAGAGGACAGAATAAAGAGGG - Intergenic
977649896 4:99457343-99457365 AAGAGAGCGCAGAAGGAATAAGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977775367 4:100913398-100913420 AAAAGCAGCCAGAAGGAAGAGGG - Intergenic
977811307 4:101358801-101358823 CAAAGATGAAAGAAGGAAGACGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
980875415 4:138657497-138657519 GAGAGAGGGCAGAAGGAGCAGGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981365918 4:143903020-143903042 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981386548 4:144138192-144138214 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981633296 4:146846583-146846605 CAAGGTGGCCAAAAGGAAGAAGG - Intronic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982326561 4:154135267-154135289 CAGATAGGACTGTAGGAAGAAGG - Intergenic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
984369564 4:178845215-178845237 CATGGAGGCCAGAAGGCAGTGGG + Intergenic
985041698 4:185897332-185897354 CAGAGAGGCCAGCAAGAATCTGG + Intronic
985168600 4:187124361-187124383 CAGAGAAGCCAGAAGTCACAGGG - Intergenic
985192387 4:187389919-187389941 CAGAGAGGCAGAAAGGAAGCCGG + Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986421049 5:7582861-7582883 AAGAGAGGCCAGAAAGAAAATGG + Intronic
986849203 5:11791148-11791170 CAGAGATGTCAGAGGGAACATGG + Intronic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
987491264 5:18582908-18582930 CTGTGAGGCCAGGAGCAAGATGG + Intergenic
987715173 5:21559210-21559232 GACAGAGGAAAGAAGGAAGACGG + Intergenic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988464947 5:31480853-31480875 AAGAAAGGAGAGAAGGAAGATGG + Intronic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
988714046 5:33807067-33807089 CAGAGAGGCCAGAGGAGAAAGGG - Intronic
988715040 5:33817389-33817411 TAGAGAGGGAAGAATGAAGAGGG - Intronic
988890325 5:35609615-35609637 CAGAGAGGCCAAAAAGAATCTGG + Intergenic
988907227 5:35802140-35802162 CAGAGAGGCAGGAAAGGAGAGGG - Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989234842 5:39134880-39134902 CAGACAACCCAGAAGGAAAATGG - Exonic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990042165 5:51388714-51388736 TAGAGCTGCCAGAAGGCAGAAGG - Intronic
990095593 5:52108383-52108405 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
990277489 5:54213599-54213621 AAGAGAGGCAGGAAGGGAGAGGG + Intronic
990425998 5:55689701-55689723 TAGAGAAGCCTGAAGAAAGAGGG - Intronic
991030960 5:62081898-62081920 CAGCGAGGCCAGAAGGAATGTGG + Intergenic
991144939 5:63290165-63290187 GAGAGTGGCAAGAAAGAAGAAGG - Intergenic
991244673 5:64497638-64497660 CAGAGAGGAAAAAAGGCAGAGGG - Intergenic
991402548 5:66268835-66268857 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
991403081 5:66274569-66274591 CAGAAAGGCGAGAAAGAACAAGG - Intergenic
991674321 5:69076175-69076197 GAGAGAGGCAAGAAGCAAGGAGG - Intergenic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
992094334 5:73347240-73347262 CATGGAGGCCAGAAGGCAGTAGG + Intergenic
992623447 5:78616035-78616057 AACAGAGGGCAGAAGGAAGGAGG - Intronic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
994079317 5:95688712-95688734 CAGAAAGGTGAGAAGGTAGAAGG + Intronic
995366156 5:111363687-111363709 AAAAGAGGCCTGATGGAAGAGGG + Intronic
996304857 5:122035453-122035475 GACAGAGCACAGAAGGAAGATGG - Intronic
996647228 5:125830653-125830675 CAGAGAAGCCAGAAGTCAGCAGG + Intergenic
997716883 5:136049169-136049191 CAGAGAGGACAGCAGGGACAAGG + Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998401673 5:141851781-141851803 TGGAGAAGCCAGAAGAAAGAGGG - Intergenic
999198951 5:149802535-149802557 TCGAGAAGCCAGAAGGAAGGAGG - Intronic
999203472 5:149832624-149832646 GAGAGAGGCCAGAGTGAGGAAGG - Intronic
999259331 5:150228293-150228315 GAAAGAAGCCAGAGGGAAGAGGG + Intronic
999287170 5:150401001-150401023 GAGAGAGGCCAGATGGTGGAGGG - Intergenic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999660305 5:153855392-153855414 CACACAGGCCAGAAGGGAGTGGG - Intergenic
999806033 5:155082148-155082170 CTGAGAGGTTAGAAGCAAGATGG + Intergenic
999925619 5:156372950-156372972 CTGAGATGCCATAATGAAGATGG + Intronic
999969942 5:156849353-156849375 CACACAGGCCAGAAGGGAGTAGG + Intergenic
1000021519 5:157322911-157322933 TAGATAGGAGAGAAGGAAGAGGG - Intronic
1000382182 5:160639063-160639085 CACAGAGGCAGGAAGGAAAATGG - Intronic
1000442260 5:161277886-161277908 CACAGAGACCAAAAGGAAGATGG - Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001087801 5:168714086-168714108 CAGCTAGGACAGCAGGAAGATGG + Intronic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1001182012 5:169529299-169529321 CAGAGAGGGCAGGAGGTAGAAGG - Intergenic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1003047405 6:2746376-2746398 CATAGAGGAAAGAAGGAAGATGG + Intronic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1005298678 6:24450112-24450134 CAGAGATGCCAGAAAGTAGAGGG + Intronic
1005522824 6:26614830-26614852 GAGAGAGACGTGAAGGAAGAGGG - Intergenic
1006164075 6:32054238-32054260 CAGGGAGGCCAGTAGGCAGTTGG - Intronic
1006164701 6:32057436-32057458 CAGCGAGGCCAGTAGGCAGTTGG - Intronic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1006670725 6:35728349-35728371 TAGAGGGGCGAGAAGGCAGAGGG - Intronic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1006731013 6:36236144-36236166 TGGGGAGGCCAGAAGGAGGATGG - Intergenic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007108161 6:39297453-39297475 CAGTGAGGCCACAAGCACGAGGG - Intergenic
1007278300 6:40691611-40691633 CAGAGGGGCCACATGAAAGATGG - Intergenic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007385545 6:41518067-41518089 CAGGGAGGAAAGAAGGGAGAGGG - Intergenic
1007509071 6:42361771-42361793 CAGAGCTGCCTGAAGGAGGATGG - Intronic
1007673892 6:43579295-43579317 CAGAGAGGCCAGGAAGAATCTGG + Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1008543392 6:52564973-52564995 CAGAGAAGCATGAAGGAGGAGGG + Intronic
1008809504 6:55478236-55478258 CGGAGAGGTGAGAAGGTAGAGGG - Intronic
1009393818 6:63173540-63173562 CAAAGAGCCCAGAGGAAAGAGGG - Intergenic
1009769564 6:68127493-68127515 CATGGAGGACAGAAGGAAGTAGG - Intergenic
1010201241 6:73283993-73284015 GAGTGAGGCTAGAAGCAAGATGG - Intronic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010800379 6:80168317-80168339 GAGAGAGGGGAGAGGGAAGAAGG + Intronic
1010831926 6:80541520-80541542 GTGGGAGGCAAGAAGGAAGATGG - Intergenic
1011090155 6:83588819-83588841 CAGAGAGGCCACAATGGAGGAGG + Intronic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1012224346 6:96687726-96687748 AAGAAAGGCAAGAAGCAAGATGG + Intergenic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013769705 6:113614012-113614034 CTGCGAGGCTAGAAGCAAGATGG + Intergenic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1014795329 6:125718032-125718054 GAGAGAGGGAAGAAGAAAGAAGG + Intergenic
1014856860 6:126412376-126412398 CAAGGAGGCCAGAAGGCAGTGGG - Intergenic
1014987717 6:128032268-128032290 CATAGAGCCCAGAAGCAAGAGGG - Intronic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015563664 6:134543190-134543212 TGCAGAGGCCAGAATGAAGATGG + Intergenic
1015697595 6:135998877-135998899 GAGAGAGGAAAGAAGGAGGAGGG + Intronic
1015788674 6:136944560-136944582 CAAAAAGGCAAGTAGGAAGAAGG - Intergenic
1016829154 6:148416598-148416620 CTCAGAGGCCTGCAGGAAGAGGG + Intronic
1016943922 6:149510297-149510319 CACAGAGGGAAGAAGGAAAAGGG + Intronic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1017271509 6:152512899-152512921 TCCAGAAGCCAGAAGGAAGATGG + Intronic
1017711024 6:157168118-157168140 CAGAGAGGCCAGAAAGGAGGTGG - Intronic
1017751793 6:157495538-157495560 CAGAGAGGCATGAGGGAAGGAGG + Intronic
1017753521 6:157510592-157510614 AAGAGAGGTCAGAAGGTAGGGGG - Intronic
1018004144 6:159604599-159604621 CTGAGATGCCAGTAGGGAGAAGG - Intergenic
1018224584 6:161616015-161616037 GAGAGCGGCCAGAAGAGAGACGG - Intronic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018772330 6:166982194-166982216 GAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1019034112 6:169040592-169040614 CAGAGAGGGGAGAAGAGAGAGGG + Intergenic
1019195336 6:170278399-170278421 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
1019463398 7:1173215-1173237 CAGAGAGGGCAGAATGGAGCTGG + Intergenic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019596506 7:1860865-1860887 CGGAGAGCCCAGAAGGCACAGGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020105291 7:5419897-5419919 CTGAGAGACCCCAAGGAAGAGGG + Intronic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1021015677 7:15528569-15528591 CAGAGAGTTCAGAAGACAGAGGG + Intronic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021322987 7:19234418-19234440 AAGACAGGCCAGAAGAAAGGAGG + Intergenic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1022180297 7:27912558-27912580 CAGAGAGGGAGGAAGGAAGAGGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022419531 7:30207430-30207452 CAGAGAGACCAGAATTTAGAAGG - Intergenic
1022420950 7:30222924-30222946 CAGAGAGGCCTGCAGGAACCTGG + Intergenic
1022791592 7:33694579-33694601 CATAGAGGGAAGAAGCAAGAAGG - Intergenic
1023020834 7:36010514-36010536 AAGAGATGCCAGAAGGTGGATGG - Intergenic
1023461068 7:40397836-40397858 CAGAGTGGACAGAAGGGATATGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024141719 7:46468870-46468892 CAGAGAGGGAAGGAGGAAAAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024297481 7:47857071-47857093 CTGAGAGGTCAGGAGGAACAGGG - Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024534679 7:50420360-50420382 CAGCAAGGCCAGAAGGACCAAGG - Intergenic
1024695074 7:51847527-51847549 CAGAGAGGAAAGAACAAAGAGGG - Intergenic
1025744888 7:64233945-64233967 AAGAGAGTCAAGAAGGATGAAGG + Intronic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1026065638 7:67070053-67070075 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1026156137 7:67827420-67827442 CTGAGGGGCCACAAGGCAGAAGG - Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026711237 7:72741807-72741829 CATGGAGGCCAGAAGGCAGTGGG + Intronic
1026761633 7:73131235-73131257 GCAAGAGGCCAGAAGGAAGCAGG + Intergenic
1027037973 7:74940056-74940078 GCAAGAGGCCAGAAGGAAGCAGG + Intergenic
1027085588 7:75261418-75261440 GCAAGAGGCCAGAAGGAAGCAGG - Intergenic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1027197118 7:76038280-76038302 CAGAGAGGTCTGAAGGAATGTGG + Intronic
1028136087 7:87224377-87224399 CAGAAAGGCCATATGGGAGAAGG - Intergenic
1028489796 7:91398615-91398637 CAGAGTGCCCTGAAGGGAGATGG - Intergenic
1028539197 7:91923825-91923847 CACAGAGGCCAGAAGGGATAAGG + Intergenic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1028706965 7:93860355-93860377 CATGGAGGCCAGAAGAAAGTAGG + Intronic
1029365334 7:100112845-100112867 AAGCCAGGCCAGGAGGAAGACGG - Exonic
1029478361 7:100798636-100798658 CAGGGAGGGCAGAAGGAACAGGG + Intergenic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029682125 7:102118574-102118596 TGGAGAGGCATGAAGGAAGATGG + Intronic
1030468739 7:109936800-109936822 TTGTGAGGCCAGAAGCAAGATGG - Intergenic
1031363107 7:120870607-120870629 AAGAGAGGCCAGAAGACAGTGGG + Intergenic
1031449152 7:121893062-121893084 CAGAGAGGCAGGAAGGAGGGAGG + Intronic
1031832488 7:126644980-126645002 CTCAGAGGTCAGAAGTAAGATGG - Intronic
1032466447 7:132148627-132148649 CAGAGTGGCGACAAGGAAGTGGG - Exonic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1032782618 7:135176281-135176303 AATAAAGGCCAGAAGGAAAAAGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033526185 7:142216129-142216151 CAGAGAGGCCAAATGCAGGATGG - Intronic
1034228629 7:149501765-149501787 TGGAGAGGCCAGAAGGAGGATGG + Intergenic
1034263635 7:149771779-149771801 GAGAGAGGGCGGAAGGCAGAGGG - Intronic
1034392195 7:150795339-150795361 CAAAGAGGCCAGAAGGCATAGGG - Intronic
1034402581 7:150874748-150874770 AAAAGAGGCCAGAACTAAGATGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034605331 7:152307390-152307412 AAGGGAGGGGAGAAGGAAGAAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035777788 8:2203083-2203105 CACAGAGCTCAGCAGGAAGAGGG - Intergenic
1036115756 8:5959187-5959209 CAGGGAGCCCAGAAGCAAAAGGG + Intergenic
1036424226 8:8628487-8628509 CAGGGAGGGCAGAAGGAAAATGG - Intergenic
1037109165 8:15145135-15145157 CAGAGAAGCCAGAAGGACTGAGG - Intronic
1037860173 8:22399281-22399303 TAGAGAGGAAAGAAAGAAGAGGG - Intronic
1037953247 8:23033032-23033054 CATAGAGCCCAGAAGGGAGTGGG + Intronic
1038090596 8:24248663-24248685 CAGACAGACCAGGAAGAAGATGG + Intergenic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038950345 8:32407622-32407644 GAGAGAGGTAAGGAGGAAGAAGG - Intronic
1038965068 8:32562609-32562631 CTGAGAGGGCTGAAGGATGACGG + Intronic
1039178794 8:34839937-34839959 CAGAGAGGCCAGGATGAGGGAGG - Intergenic
1039215794 8:35269313-35269335 CAGAGAGACAGGAAGGAAGATGG - Intronic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1039358964 8:36854042-36854064 AATAGAGGCCAGAAAGAAGTAGG - Intronic
1039407852 8:37328236-37328258 GAGAGAGAGAAGAAGGAAGAAGG - Intergenic
1039429887 8:37517558-37517580 CAGGGCGGCCAGCAGGGAGAGGG - Intergenic
1039538922 8:38345320-38345342 CAGAGAGGGGAGCAGGGAGAGGG + Intronic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1039824525 8:41161732-41161754 GAGGGAGGCAAGAAAGAAGAAGG - Intergenic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1039978597 8:42387791-42387813 CAGAAAGACCTGAAGCAAGAAGG - Intergenic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1041167834 8:55108194-55108216 CAGAGAGGCAAGAAAGAACAAGG + Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041475177 8:58257218-58257240 TGGAGATGCCAGAAGGAATAAGG + Intergenic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1042319225 8:67457532-67457554 CAGAGAGGATGGAAAGAAGAAGG - Intronic
1042482511 8:69319892-69319914 GAGAGAGGCCAGAAGAATGATGG + Intergenic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042824429 8:72965716-72965738 CTGCGAGGCCAGAAGCAGGATGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1042942121 8:74118374-74118396 GAGAGAGGGAAGAAGGAAGGAGG - Intergenic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1043444287 8:80304187-80304209 CATGGAGGTCAGAAGCAAGATGG + Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045322561 8:101092814-101092836 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
1045362154 8:101442667-101442689 GCGAGAGGCCTGCAGGAAGAGGG - Intergenic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045640734 8:104247573-104247595 CAGAGAGGAAGGAAGAAAGATGG + Intronic
1045648008 8:104317985-104318007 CTGAGAGGCTAGAAGCAAGATGG + Intergenic
1045683375 8:104686531-104686553 CAGCAAGGCCATAAGGGAGAAGG + Intronic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1046250460 8:111624234-111624256 TGGGGAAGCCAGAAGGAAGATGG + Intergenic
1046324012 8:112616716-112616738 CAAACAGGCCAGATGGCAGATGG + Intronic
1046628793 8:116603188-116603210 CAGAGAGACAAGGAGCAAGAGGG - Intergenic
1047486340 8:125334435-125334457 CAGAGAGCCTAGAAGGAGCATGG + Intronic
1047818295 8:128489396-128489418 CAGAGAGGACAGTAGGCAGGAGG + Intergenic
1048000712 8:130377494-130377516 CACAGAGGCCAGCAGGCAGGAGG - Intronic
1048176081 8:132154011-132154033 AAGAGAGGACAGGAGGAAAAAGG - Intronic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048586476 8:135778627-135778649 CAGTGAGGCCAGTATGAAAAGGG - Intergenic
1049278565 8:141732262-141732284 CAGGGAGCCCAGAAGGACAATGG - Intergenic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049703184 8:144024179-144024201 AAGAGAGTCCTGAAGGGAGAGGG - Intronic
1049703469 8:144025203-144025225 AAGAGAGTCCTGAAGGGAGAGGG - Intronic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050307562 9:4320841-4320863 AAGAGAGACCAGAATGAATATGG - Intronic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051598359 9:18847811-18847833 CAGAGAGGCAACCAGGCAGAGGG + Intronic
1051603461 9:18897147-18897169 CAGGGAGGCCAGATGGATCAGGG - Intronic
1051816512 9:21113371-21113393 CACAGAGGCCAGAGGGTAGTGGG + Intergenic
1051862264 9:21639424-21639446 CATGGAGGACAGAAAGAAGAAGG + Intergenic
1052444458 9:28542378-28542400 CAGAGAGGCCTAAGGAAAGATGG + Intronic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053329099 9:37187909-37187931 CACAGAGGACAAAAGGAAGTAGG - Intronic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1054453933 9:65420138-65420160 GGGAGGGGCAAGAAGGAAGAAGG + Intergenic
1055498919 9:76884072-76884094 GAGAGAGGAGAGAAGGGAGAGGG - Intronic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1055907841 9:81314567-81314589 CAGCGTGGCTAGAAGGAAGCAGG + Intergenic
1056136278 9:83632213-83632235 GAGAGAGACGGGAAGGAAGATGG - Intronic
1056755163 9:89377060-89377082 CAGAGAGGACAGAAAAGAGAGGG + Exonic
1057229487 9:93311093-93311115 CAGAGAGACCAGAAGCAGAATGG - Intronic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1057787159 9:98095892-98095914 CAGAGAGTCGGGATGGAAGATGG - Intronic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1059301261 9:113315319-113315341 AAGAGAGGGAAGAAGGAAGGTGG + Exonic
1059347239 9:113637316-113637338 CGGCCAGGGCAGAAGGAAGAGGG - Intergenic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059857541 9:118416588-118416610 GAGAGAGGCCATAAGGATGATGG + Intergenic
1060244389 9:121931860-121931882 GAGAAAGGCATGAAGGAAGATGG - Intronic
1060253576 9:122005520-122005542 CAGAGAGGGCACCAGCAAGAAGG - Intronic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1061950081 9:133931284-133931306 CAGAGAGCCCAGCAGCAGGAGGG + Intronic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1062415714 9:136448541-136448563 CAGAGACGCCAGGAGGATGGAGG + Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1203467771 Un_GL000220v1:103901-103923 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1203475596 Un_GL000220v1:147877-147899 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1185648055 X:1629060-1629082 AAGAAAGGAAAGAAGGAAGAAGG - Intronic
1185978724 X:4750932-4750954 CAGAGTGGCCTGGAGAAAGAAGG - Intergenic
1186107142 X:6219632-6219654 AAGAAAGGACGGAAGGAAGAAGG - Intronic
1186365629 X:8890345-8890367 CAAAGAGGCCAGAAGCAAATTGG + Intergenic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1186530222 X:10287607-10287629 AAGAGAAGCCACAAGCAAGATGG + Intergenic
1186586319 X:10877106-10877128 CAGAGAGGCAAGAAAGAAAGGGG - Intergenic
1186735271 X:12456517-12456539 CAGAGAGGGAGGGAGGAAGAAGG - Intronic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187488761 X:19729757-19729779 AACAGAGGAAAGAAGGAAGAAGG + Intronic
1187862092 X:23692422-23692444 CAGAGAGGCCAACAGGAATCTGG - Intergenic
1189083941 X:38000776-38000798 TAGCGAAGCCAGAAGGGAGATGG + Intronic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189423163 X:40874721-40874743 AAGAGAGGGTAGAAGTAAGAAGG - Intergenic
1189453142 X:41158398-41158420 CATTGAGGCCAGAAGGCAGTAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189931652 X:46018465-46018487 CAAAGAGTACAGTAGGAAGAGGG - Intergenic
1190221912 X:48517226-48517248 CAGGTAGGCCAGGTGGAAGATGG - Exonic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190990559 X:55545389-55545411 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1191104123 X:56761807-56761829 GAGAGAGGGCAGAAAGGAGAGGG - Intergenic
1192144472 X:68672229-68672251 CAGATTGGCCTTAAGGAAGAAGG - Intronic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192344036 X:70286624-70286646 GAGAGAGGCTAGGAGGAGGAAGG + Exonic
1192861854 X:75082259-75082281 CACAGAGGCCAGCAGTAAGTGGG + Intronic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1194979777 X:100428444-100428466 CGTAGAGGCCATAAGGAAGAAGG - Intergenic
1195343590 X:103927092-103927114 CAGAAAGGCCAGGAAGCAGATGG - Intronic
1195363391 X:104106226-104106248 CAGAAAGGCCAGGAAGCAGATGG + Intronic
1195755987 X:108199087-108199109 CAGAGGGGCCAAGAGAAAGAAGG + Intronic
1195804086 X:108743143-108743165 AGGAAAGGGCAGAAGGAAGAAGG + Intergenic
1195825388 X:108994504-108994526 AAGAGAGGAATGAAGGAAGACGG - Intergenic
1196006649 X:110843901-110843923 TGGGGAGGCCAGAAGGAAGATGG - Intergenic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1196615663 X:117764292-117764314 CAGATAGGCCAGAAGGACTAGGG - Intergenic
1196649050 X:118150202-118150224 CTTGGAGGCCAGAAGCAAGATGG - Intergenic
1196720511 X:118849327-118849349 AAGACTGGCCAGAAGGTAGAAGG + Intergenic
1196869138 X:120096339-120096361 TGGAGAGGCCAGAAGGGGGATGG - Intergenic
1196910567 X:120480701-120480723 TACAGAGGGCAGAAGGAAGAAGG - Intergenic
1196931019 X:120682133-120682155 TGTAGGGGCCAGAAGGAAGATGG - Intergenic
1196963970 X:121035393-121035415 CACAGAGGTAAGAATGAAGATGG + Intergenic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1197669954 X:129265484-129265506 CATAGATGCCAGAAAGAACAAGG - Intergenic
1197926113 X:131648072-131648094 TAGAGAGACCACTAGGAAGAGGG - Intergenic
1198040582 X:132847675-132847697 CAGAGGGACCAAAAGGGAGAGGG + Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198692478 X:139299385-139299407 CACAGAGGTAAGAAGGAAAAAGG + Intergenic
1198770312 X:140123864-140123886 CAGAGAGGCAAAAGGAAAGATGG - Intergenic
1199069778 X:143462613-143462635 TGGAGAGGCCAGAAGGGGGATGG - Intergenic
1199460659 X:148081032-148081054 CAGAGAGGTCACAAGGCTGATGG + Intergenic
1199534258 X:148884476-148884498 AAGAGAAGCCAGAAGGGAAAAGG - Intronic
1199598895 X:149528841-149528863 CACAGAGGAAAGAAGAAAGAAGG + Intronic
1199688303 X:150284355-150284377 CATGGAGGCCAGAAGGTAGTGGG + Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1200315639 X:155129954-155129976 CATAGAGGCCAGAAGGCAGTGGG + Intronic
1200797253 Y:7352323-7352345 CCCAGAGACCAGAAGAAAGATGG - Intergenic
1201253890 Y:12088330-12088352 GAGAGAGGAAGGAAGGAAGAAGG - Intergenic
1201298708 Y:12487793-12487815 CAGAGAAGCCAGTGGGAAAATGG + Intergenic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1202174150 Y:22082105-22082127 TCTTGAGGCCAGAAGGAAGAAGG - Exonic
1202217210 Y:22504277-22504299 TCTTGAGGCCAGAAGGAAGAAGG + Exonic
1202325976 Y:23691782-23691804 TCTTGAGGCCAGAAGGAAGAAGG - Intergenic
1202544795 Y:25978272-25978294 TCTTGAGGCCAGAAGGAAGAAGG + Intergenic