ID: 1150209375

View in Genome Browser
Species Human (GRCh38)
Location 17:63433831-63433853
Sequence CCCTGGGAAGCTCTGAGATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150209375_1150209383 1 Left 1150209375 17:63433831-63433853 CCTCATCTCAGAGCTTCCCAGGG 0: 1
1: 0
2: 3
3: 34
4: 338
Right 1150209383 17:63433855-63433877 CCAGTCCCTCCCCTCTCCTGGGG 0: 1
1: 0
2: 3
3: 51
4: 547
1150209375_1150209380 -1 Left 1150209375 17:63433831-63433853 CCTCATCTCAGAGCTTCCCAGGG 0: 1
1: 0
2: 3
3: 34
4: 338
Right 1150209380 17:63433853-63433875 GGCCAGTCCCTCCCCTCTCCTGG 0: 1
1: 1
2: 5
3: 96
4: 508
1150209375_1150209381 0 Left 1150209375 17:63433831-63433853 CCTCATCTCAGAGCTTCCCAGGG 0: 1
1: 0
2: 3
3: 34
4: 338
Right 1150209381 17:63433854-63433876 GCCAGTCCCTCCCCTCTCCTGGG 0: 1
1: 0
2: 3
3: 57
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150209375 Original CRISPR CCCTGGGAAGCTCTGAGATG AGG (reversed) Exonic
900205531 1:1430601-1430623 TCCTGGGAAGCTCTTGGCTGAGG + Intergenic
900378828 1:2373691-2373713 GCCTGGGGAGCACTGAGAGGTGG - Intronic
900634692 1:3657228-3657250 CCCTCGGAGGCTCTGAGAGGGGG + Intronic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900788639 1:4665575-4665597 CCCTGGGGAGCACTGGGCTGGGG + Intronic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
900979012 1:6035621-6035643 CCCTGGGAAGAACTGGGCTGGGG + Intronic
900998717 1:6136688-6136710 CCCCGGGAAGCTCTGGGGTCTGG + Intronic
902041701 1:13497184-13497206 CCCTGGAGAGCTCTGAGCCGAGG + Intronic
902300899 1:15502152-15502174 CCCTGGTCAGCTCTGAGGGGAGG - Intronic
902644383 1:17788394-17788416 GGCTGGGAAGCTCTGAGCTGAGG - Intronic
903190980 1:21655879-21655901 CCCTGGGAAGATCTCAGGTCTGG + Intronic
903344689 1:22676881-22676903 CCCTGGGAAATTCTGGGAGGTGG + Intergenic
905464391 1:38141665-38141687 CCATGGGGAGCTGTGAGCTGGGG + Intergenic
905533189 1:38698532-38698554 GGGTGGGAAGCTCTGAGCTGGGG - Intergenic
905942286 1:41873760-41873782 CTCTGGGATTCTCTGATATGAGG - Intronic
906506018 1:46380185-46380207 CCCTGGCACCCTCTGAGGTGGGG - Intergenic
906514262 1:46429572-46429594 AGCTGGGGAGCTCTGAGCTGAGG + Intergenic
907784133 1:57595493-57595515 CTCTGGGAGGCTTAGAGATGTGG + Intronic
907973847 1:59412062-59412084 TCCTGAGAAGATCTGATATGGGG - Intronic
909104721 1:71393684-71393706 ACCTGGGATCCTCTGAGCTGAGG - Intergenic
909531359 1:76685236-76685258 CCCTGGGGTGTTCTGAGCTGAGG - Intergenic
910363386 1:86437632-86437654 CACTGGGTAGATCTGAGAGGTGG + Intronic
914197996 1:145460076-145460098 CCCAGGGTCGCTCTGAGAGGGGG - Intergenic
914477098 1:148033208-148033230 CCCAGGGTCGCTCTGAGAGGGGG - Intergenic
914988055 1:152476533-152476555 CCCTGTGGAGCTGTGAGAAGAGG - Intergenic
915657004 1:157369007-157369029 CCCTGAGAAGTTCTGGGCTGGGG + Intergenic
915671987 1:157497308-157497330 CCCTGAGAAGTTCTGGGCTGGGG - Intergenic
915708094 1:157865971-157865993 CTCTGGGAAGCTCTGCTGTGAGG + Intronic
916264749 1:162879724-162879746 CCTTGAGAAGCTCAAAGATGAGG + Intergenic
918097716 1:181348559-181348581 TCCTGGGAAGCTGTGTGAGGTGG + Intergenic
918143839 1:181738944-181738966 CCCTGGGTGACTATGAGATGGGG + Intronic
918552467 1:185758910-185758932 ACCTGTGAAGGTCTTAGATGAGG - Intronic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
920065134 1:203263820-203263842 CCCTGGGAAGGTCTGTGGTGCGG + Intronic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
922682780 1:227614677-227614699 GACTGGGAAGATCTGAGCTGGGG - Intronic
923092001 1:230747884-230747906 GCCTGGGATGCTCTGCGGTGGGG + Intronic
923390433 1:233509837-233509859 CCATTGGAAGCACTGAGAAGAGG + Intergenic
1062860891 10:808245-808267 CCCTGGGAAGAACTAGGATGAGG - Exonic
1063154777 10:3369073-3369095 CCTCTGGAAGCTCTGAGATGGGG - Intergenic
1064766905 10:18684522-18684544 CCCTGGGAAACCCTCAGAGGTGG - Intergenic
1066521796 10:36228453-36228475 CCCTGGGAGGATCTAAGATCTGG - Intergenic
1066666624 10:37789510-37789532 CCCTTGAAAGCACTGAGAAGGGG - Intronic
1068921497 10:62489441-62489463 CCCTGCAAAGCTCTGAGAAGAGG + Intronic
1069590116 10:69636193-69636215 CCCTGAAAGGCTCTGAGAGGCGG - Intergenic
1070421621 10:76243083-76243105 GGCTGGGAAGTTCTGAGGTGTGG - Intronic
1071470758 10:85982585-85982607 CCCGTGGCAGCTCTGTGATGTGG + Intronic
1072623344 10:97095415-97095437 CCCTGGGAAGCCCCAAGAAGAGG - Intronic
1074041379 10:109793147-109793169 CCCAGGGTAGCTGTGAGAAGAGG - Intergenic
1074865209 10:117540821-117540843 CCCTGGGAAGGTGTGGGGTGGGG + Intergenic
1075668107 10:124244965-124244987 CTCTGCTAAGCTCTGAGGTGGGG - Intergenic
1076207167 10:128612505-128612527 CCCAGGCAAACTCTGAGCTGTGG + Intergenic
1076369234 10:129941010-129941032 ACCTGGGAAGCTCTAAGAGCAGG - Intronic
1076608747 10:131707101-131707123 GCCTGGCGACCTCTGAGATGAGG + Intergenic
1077087708 11:762929-762951 CCCTGGTGAGTTCTGGGATGAGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078496685 11:11824714-11824736 CCCAGTGGAGCTGTGAGATGAGG - Intergenic
1079077788 11:17394631-17394653 CCCTGGGCAGTTCTGGGAGGGGG + Intronic
1080246621 11:30186244-30186266 GACTGGGTAGCTCTGAGAAGGGG + Intergenic
1081170471 11:39863684-39863706 CCATGGGAACCTCTGGAATGTGG - Intergenic
1081816672 11:45948293-45948315 CCATGGGAAGGTCTGAAATATGG + Intronic
1083224109 11:61273861-61273883 CCCTGGGAAGCTCTGGGCAGTGG - Intronic
1083276311 11:61598993-61599015 TACTGGGAAGCTCTGGGAAGAGG + Intergenic
1083702097 11:64486243-64486265 GCCTGGGAAACTTTGAGATGGGG + Intergenic
1083888464 11:65584130-65584152 CCCCTGCAAGCTCAGAGATGGGG + Intronic
1084117636 11:67051297-67051319 CCTTGGGAAGCTCAGAGGAGGGG + Intergenic
1084288495 11:68146885-68146907 CCCTGGGAGGCCCTGAGGAGTGG - Intergenic
1087574784 11:99976349-99976371 CCCAGTGGAGCTTTGAGATGAGG - Intronic
1089378085 11:118009140-118009162 CAGTGGGAAGCTCAGAGCTGAGG + Intergenic
1090228082 11:125083541-125083563 CCCTGGCAAGCTCTGGGATCTGG - Intronic
1090395190 11:126414177-126414199 GCCTGGCCAGGTCTGAGATGAGG + Exonic
1090832076 11:130427126-130427148 CCCTGGGAGCCTCTCAGATCTGG + Intronic
1091136691 11:133197504-133197526 CCATGAGAAGCAGTGAGATGTGG - Intronic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1091304169 11:134526514-134526536 CCCTGGGTAGCTCTCATAAGTGG + Intergenic
1091740277 12:2956278-2956300 CCCTGGGAAGGGCTGATGTGTGG + Intergenic
1092724775 12:11474740-11474762 CCCTGGGACTCTTTGAGCTGGGG - Intronic
1094782719 12:33811376-33811398 CTCTGGGAAAATCTCAGATGAGG + Intergenic
1095639288 12:44468285-44468307 CCTTGGGAAGCTCTGCCCTGTGG - Intergenic
1096687427 12:53297858-53297880 CCCTGGGAAGCTGCATGATGTGG + Exonic
1100164488 12:91901063-91901085 CCTTGAGAAGCTGTGAGAGGAGG + Intergenic
1100758048 12:97773777-97773799 CCCTAGGTAGCTTTGGGATGAGG - Intergenic
1102346130 12:112162559-112162581 CCCTGGGAGCCTCACAGATGTGG - Intronic
1102770192 12:115469478-115469500 CCCTAGGAAGCCATGCGATGGGG - Intergenic
1102796843 12:115696270-115696292 TCCTGGGAAGTTCTGAGCAGAGG + Intergenic
1102886139 12:116523384-116523406 ACCTGGGAAACTTTGAGGTGAGG - Intergenic
1103223650 12:119267722-119267744 CCCTGGGCAGCTCTGCCCTGTGG - Intergenic
1103227059 12:119296794-119296816 CCCTGGTTATCTCTGAGCTGTGG + Intergenic
1104666305 12:130649720-130649742 CCCTGAGAAAATCAGAGATGTGG + Intronic
1104805295 12:131586012-131586034 CCCTGGGGACCACTGTGATGGGG + Intergenic
1110566820 13:76965536-76965558 CCCTGAGAAAGCCTGAGATGGGG + Intergenic
1110924372 13:81131835-81131857 CCTAGTGAAGCTCTGAGAAGAGG + Intergenic
1113438500 13:110310975-110310997 CCCTGGGAAGCTCGGTGTGGAGG - Intronic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1113877216 13:113601886-113601908 CCCTCTGTAGCTCTGAGAGGAGG + Intronic
1113877220 13:113601920-113601942 CCCTCTGTAGCTCTGAGAGGAGG + Intronic
1114178289 14:20343321-20343343 CCTTGGGAAGGTCTGAGACTAGG - Intergenic
1115525081 14:34271804-34271826 CCATGGGAAGCACTAAGAAGTGG - Intronic
1115816060 14:37165710-37165732 CCCTGGGAGGTTCTGAGGTTGGG + Intronic
1116971973 14:51075733-51075755 CCTTGGGAAGTTTTGAGAGGTGG - Intronic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1120506189 14:85355732-85355754 CCCTAGGCAGCTTTGGGATGGGG + Intergenic
1123042277 14:105495335-105495357 CCCTGGGCAGGCCTGGGATGAGG - Intronic
1124619565 15:31266047-31266069 CCCTGGGTAGCCCTCAGAGGAGG + Intergenic
1126369411 15:47929640-47929662 CCCTGTTAAACTCTGAGATGTGG + Intergenic
1126696994 15:51334849-51334871 CCCTGGGAAGGTATGACCTGGGG - Intronic
1127284979 15:57524529-57524551 CCCTGGGATGCTCTGAGACCAGG - Intronic
1128777155 15:70329275-70329297 CAATGGGAAGCTCAGAGAGGCGG + Intergenic
1129325384 15:74797876-74797898 CCCGGAGCAGCTCTGAGAAGGGG - Intronic
1129333269 15:74838493-74838515 CCCGGGCCATCTCTGAGATGAGG + Exonic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1129875171 15:78970460-78970482 CCATGGGAAGCCCTGAAAGGAGG - Intronic
1129937908 15:79466000-79466022 CTCTGGGAAGCTCAGGGAAGAGG + Intronic
1129976229 15:79824311-79824333 ACCTAGGGAGCTCTGAGATAAGG + Intergenic
1130355856 15:83129803-83129825 CCCAGGGAAACACTGAGGTGTGG + Exonic
1131872955 15:96779669-96779691 CCCTGGGAAGTTCAGTTATGAGG - Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1132661678 16:1064306-1064328 CCCTGGGAAGCTGGGGGCTGTGG + Intergenic
1134027603 16:10966258-10966280 ACCTGGAAAGCCCTCAGATGTGG + Intronic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1135800433 16:25489135-25489157 CCCTGGGAAGCACTTTGATTGGG + Intergenic
1137806549 16:51311676-51311698 CCCTGTCAAGCTTTCAGATGAGG + Intergenic
1138256429 16:55567259-55567281 CTCTGGGAAGTTCTCAGCTGCGG + Exonic
1138383038 16:56617079-56617101 CCCTGGGTAGGCCTGAGCTGGGG - Intergenic
1138394192 16:56691567-56691589 CCTTTGGGAACTCTGAGATGTGG + Intronic
1138421539 16:56902463-56902485 CCCCTGGAAGATCTCAGATGAGG + Exonic
1140239966 16:73191794-73191816 CCCTGGGAATCTCTTAAAAGAGG + Intergenic
1140723194 16:77789043-77789065 CCCGGGGAGGCTCTGAGACCCGG - Intronic
1142033998 16:87852539-87852561 CCCCAGGAGGCGCTGAGATGTGG + Intronic
1142196340 16:88740938-88740960 CCCCGGGAATCTCTGAGCTATGG - Intronic
1143453490 17:7050947-7050969 CGCTGAGATGCTCTGAAATGGGG + Intergenic
1143501766 17:7343451-7343473 GCCTGGGAACCTCTGCGTTGTGG - Exonic
1143693883 17:8595770-8595792 CCCTGTGAAGCTGTAAGATATGG - Intronic
1143736659 17:8916130-8916152 CCCTGGGAGCCTGAGAGATGGGG + Intronic
1144369608 17:14577415-14577437 CCCACTTAAGCTCTGAGATGTGG - Intergenic
1145052941 17:19678263-19678285 CTCTGTGAAGCTCTGAGAAGGGG - Intergenic
1145294076 17:21574464-21574486 CCCTGGGAATCGCTGTGATGGGG + Intergenic
1145369759 17:22298722-22298744 CCCTGGGAATCGCTGTGATGGGG - Intergenic
1146578570 17:34015395-34015417 CCCTGGTAGGCTCTCAGCTGTGG - Intronic
1147320737 17:39644304-39644326 CCCTGGGAGGCTAGGAGGTGGGG + Intronic
1147537943 17:41333116-41333138 CCCTGGGAAATGCTGGGATGGGG - Intergenic
1147996458 17:44362746-44362768 CACTGCGAAGATGTGAGATGAGG + Intronic
1149548052 17:57518977-57518999 CACTGGGGATATCTGAGATGGGG - Intronic
1149657283 17:58316822-58316844 GCCTGGGCCCCTCTGAGATGAGG - Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1151673219 17:75584298-75584320 ACAAGGGAAGCTCTGAGATATGG - Intergenic
1152516145 17:80826021-80826043 CCCTGGGGAGCTCTGAGGATGGG + Intronic
1156498250 18:37540272-37540294 ACCTGGGAGGCTCTGGGCTGGGG - Intronic
1160224196 18:76999337-76999359 CCATCAGAAGCTCTGAGCTGCGG + Intronic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460968 18:79037638-79037660 TCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460981 18:79037714-79037736 CCCTGGAAGGCTCTGAGACATGG - Intergenic
1160768200 19:818046-818068 CCCGGGGAGGGTCTGAGGTGGGG + Intronic
1160833046 19:1112233-1112255 CCCCGGCCAGCTCCGAGATGAGG + Exonic
1161478699 19:4499996-4500018 CCCTGGGACGCCCAGAGAGGGGG + Intronic
1162805737 19:13137181-13137203 GCCTGGGGTGTTCTGAGATGAGG + Intronic
1163061988 19:14767654-14767676 CCCTGGGCAGCTCCCAGCTGGGG + Intronic
1164507601 19:28872332-28872354 CCCCTGGAAGCCCTGTGATGAGG - Intergenic
1165013747 19:32866291-32866313 TCCTGGGCAGGGCTGAGATGAGG - Intronic
1165244499 19:34490493-34490515 CCCTGGGTAGCTCTGTGAAGGGG + Intronic
1165434560 19:35788926-35788948 TCCTGGGAGCCTCTGAGAGGTGG + Intergenic
1166523707 19:43497937-43497959 CCCAGGCAGGCTCTGAGATATGG - Intronic
1166778455 19:45326623-45326645 CCATGGCAAGCTCTGAGGAGGGG - Intergenic
1167885818 19:52499071-52499093 TCCTGAGAAGCTCTGAGGTGAGG - Intronic
926775006 2:16413399-16413421 CCCTGGGAACCTCTGACCGGTGG - Intergenic
928202476 2:29257140-29257162 CCCAGGGAGGATCTGGGATGGGG + Intronic
928944566 2:36760959-36760981 CCCTAGGGATCTCTGAGAGGGGG - Intronic
929305328 2:40354909-40354931 CCCTGGAAAACTTTAAGATGAGG + Intronic
929321909 2:40554394-40554416 CCCTTTGAATCTCTGAGAAGTGG + Intronic
932137407 2:69243277-69243299 CCCTGTGAGGCTGTGAGTTGTGG + Intronic
932616943 2:73238228-73238250 CCCTGGGAAGCTTTCAGCAGAGG - Intronic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
935155924 2:100483530-100483552 CCCTAGGTGGCTTTGAGATGGGG + Intergenic
935804514 2:106732680-106732702 CCGTGTGAAGCTGTGTGATGGGG + Intergenic
937441484 2:121919640-121919662 CCCTGGGGAGCCTTGAGCTGTGG + Intergenic
938144018 2:128819361-128819383 GCCTAGGGAGTTCTGAGATGAGG - Intergenic
938251572 2:129819953-129819975 CCCTTGGGAGCTCACAGATGAGG - Intergenic
938810935 2:134852255-134852277 CAGTGGCAAGATCTGAGATGGGG + Intronic
939664488 2:144934166-144934188 CTCTGGCAATTTCTGAGATGTGG - Intergenic
940652851 2:156454707-156454729 GCCTGGGAAGGTGAGAGATGGGG + Intronic
942053633 2:172163021-172163043 CCCTGGGAGCCACTGCGATGGGG - Intergenic
943419677 2:187655054-187655076 CCCTGGGAGTGACTGAGATGGGG - Intergenic
945428385 2:209735993-209736015 CCATGGGTACCTCTGAGATGGGG + Intergenic
946063763 2:216968496-216968518 CCCTGGAAAGCTCTAGGCTGGGG + Intergenic
946879383 2:224161969-224161991 CCCTGGAAACCTCTCAGAGGAGG - Intergenic
947285378 2:228508031-228508053 CCCTGGGAAGAGCTGACAGGAGG + Intergenic
948263178 2:236619349-236619371 CCATGGGAAGCTGAGATATGGGG + Intergenic
948818193 2:240524268-240524290 CCCAGGGTAGCTATGAGCTGAGG - Exonic
1168960194 20:1863846-1863868 CCCCAGGAAGCACTGATATGGGG + Intergenic
1169236067 20:3930874-3930896 CCCTGGGAAGGTCTGAGCTGAGG - Intronic
1169252588 20:4071914-4071936 CCAGGGGAAGCTCTGGGGTGTGG + Intronic
1169818945 20:9687976-9687998 TCCAGGAAGGCTCTGAGATGTGG + Intronic
1169959530 20:11143601-11143623 CTCTGGGGAGCTCTGAGAGACGG - Intergenic
1170385738 20:15814431-15814453 TACAGAGAAGCTCTGAGATGTGG - Intronic
1170437639 20:16346725-16346747 CCCTGAGAATCTGGGAGATGGGG + Intronic
1170874090 20:20234664-20234686 ACCTGGGAAGCTGTCAGAGGTGG + Intronic
1171166200 20:22974115-22974137 CCCTGAGGAGTTCTGAGCTGGGG - Intergenic
1172449866 20:35014265-35014287 CCCTTGTAATCTCTGTGATGGGG - Intronic
1172609658 20:36240486-36240508 GCGTGGGCAGCTCTGAGAAGCGG - Exonic
1172753973 20:37270555-37270577 CGCTTGGAATCTCTGAGTTGGGG + Intergenic
1172891917 20:38271567-38271589 CCCTGGGAAGCCCTGCTAGGTGG + Intronic
1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG + Intergenic
1174069077 20:47887428-47887450 CCCTGGCAAGGCCTGTGATGTGG + Intergenic
1174139234 20:48401029-48401051 TCCTGGGAAGCGCTGAGACCTGG + Intergenic
1174674925 20:52344576-52344598 CCATGGGAGGCTTTGAGAAGAGG + Intergenic
1175644200 20:60657575-60657597 CCCTGGGTAGCTGTGAGGTTGGG - Intergenic
1175905551 20:62377816-62377838 CCCCAGGAAGCGCTGAGAGGTGG + Intergenic
1176051862 20:63124188-63124210 CCCTGTGCAGGTGTGAGATGTGG - Intergenic
1176286631 21:5022281-5022303 CCCTGGGAAGCGCAGGGGTGGGG - Intergenic
1178910367 21:36668912-36668934 CCCAGTGGAGCGCTGAGATGGGG - Intergenic
1179265090 21:39796099-39796121 TCCTGGGAAGCACTTAGAGGAGG + Intronic
1179726785 21:43345447-43345469 CCCTGGGAAGTTCTGACACCCGG - Intergenic
1179870550 21:44241194-44241216 CCCTGGGAAGCGCAGGGGTGGGG + Intergenic
1181429695 22:22871579-22871601 CCCTGGGATGTTCTGACCTGTGG - Intronic
1182121553 22:27790487-27790509 CCCTGGGTGGCTCTGAGCTGGGG + Intronic
1182502040 22:30754858-30754880 CAATGGGAGGCTTTGAGATGGGG - Intronic
1182692512 22:32173913-32173935 CTCTGGGAAGCCGTGAGCTGTGG + Intergenic
1183072099 22:35403344-35403366 CCCTGGGAAGCTCAGGGATGGGG - Intronic
1183265754 22:36824158-36824180 CTCTGGGCAGCACTGGGATGGGG - Intergenic
1183614773 22:38937266-38937288 CCGTGGGAAGCCCTGGGCTGGGG - Intergenic
1183661633 22:39224891-39224913 CCCTGGCCAGCTCTGAGGGGAGG - Exonic
1184027070 22:41865721-41865743 CCCTGGGAAGCACGGAGTTCAGG + Intronic
1184660765 22:45964564-45964586 CCCTGGGAAGACCTGAGTCGGGG + Intronic
1184820861 22:46908315-46908337 CCCTGGGATTCTCTGAGGGGCGG + Intronic
1184836667 22:47027905-47027927 CCCTGGGCAGCTTTGAACTGCGG + Intronic
1185131866 22:49043819-49043841 CCCTGGGCAGGTCTGATGTGGGG + Intergenic
1185413943 22:50699698-50699720 CGCTGGGAAACTCTCAGAGGTGG - Intergenic
950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG + Intergenic
950234433 3:11306462-11306484 GCCTGGGAGGGTCTGAGAGGTGG + Intronic
950495542 3:13331894-13331916 CCCTGGGCAGGTCTGGGGTGGGG + Intronic
950657937 3:14448912-14448934 CCCTGGAAATAACTGAGATGAGG + Intronic
950715939 3:14847966-14847988 CCCTGGGAAGGCCTGAGGTGTGG + Intronic
950838415 3:15942799-15942821 TCCTGGGAAGCTCTGAAGTTGGG - Intergenic
951123435 3:18956354-18956376 CCCTTGACAGCTCTGTGATGTGG - Intergenic
952405859 3:33004667-33004689 ACATGGTAAGCTCTCAGATGTGG + Intronic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953509382 3:43520043-43520065 CACTGGGAAGCTGGGAAATGTGG - Intronic
954640288 3:52093767-52093789 CCCTGGGGAGGACTGAGATTGGG + Intronic
954716580 3:52529849-52529871 CCCAGGGAGGCTGAGAGATGAGG - Intronic
954876836 3:53807722-53807744 CCCTGTGAAGCTGGGAGCTGTGG + Intronic
954955979 3:54518441-54518463 CTCTGAGAAGCACCGAGATGGGG + Intronic
955071282 3:55574511-55574533 CCTTGGGAAGAGCTGGGATGGGG + Intronic
955447509 3:59029755-59029777 CACTGGGAAGCTCTAAGAGTGGG + Intronic
955713565 3:61805073-61805095 CCCTGGCAAGGTCAGAGAAGTGG - Intronic
956169503 3:66421686-66421708 CCTAGGGAAGCTGTGAGAAGAGG - Intronic
957609511 3:82449212-82449234 CCTAGGGAAGCTGTGAGAAGAGG + Intergenic
958952243 3:100429284-100429306 TCCAGGCAAGCTCTGAAATGGGG - Intronic
959101668 3:102017277-102017299 CCCTTGAAAGTTCTGATATGAGG - Intergenic
960971968 3:123146158-123146180 ACGTAGGAAACTCTGAGATGTGG - Exonic
961163083 3:124745950-124745972 CTCTGGGTAGCTCTGGGATGGGG + Intergenic
961406010 3:126680005-126680027 CCCAGGGAAGCTGTGACCTGGGG + Intergenic
962121472 3:132565186-132565208 CCCTGGCAAGCACTGTAATGAGG + Intronic
962810018 3:138951603-138951625 CCGTGGGATGCTCTCAGAGGCGG + Exonic
962835188 3:139183564-139183586 CCCTGGGCACAGCTGAGATGAGG + Intronic
962982739 3:140505488-140505510 CCCCAGTGAGCTCTGAGATGTGG + Intronic
963961039 3:151309615-151309637 ACATGGAAAGCTCTGAGAAGAGG - Intronic
964409737 3:156385209-156385231 CCTAAGGAAGCTCAGAGATGAGG + Intronic
967753328 3:193140300-193140322 CCCCGGGAGGGGCTGAGATGAGG - Intergenic
967950053 3:194833654-194833676 CCCTGTGAAACTCCGAGCTGAGG + Intergenic
968213490 3:196868355-196868377 GCCGGGAAAGCTCTGAGAGGAGG + Intronic
969393428 4:6906114-6906136 CCCTTGGTGGCTCTGAGCTGGGG + Intergenic
969676634 4:8618049-8618071 CCCTGGGTCCCTCTGAGCTGAGG - Intronic
970142721 4:12999768-12999790 CCCTGGAGAGCTCAGTGATGTGG - Intergenic
970698763 4:18709974-18709996 CCCAGGGAAGCCCAGAGCTGAGG - Intergenic
971454559 4:26832123-26832145 CCCTGGGAAGATTTGGCATGTGG - Intergenic
971893900 4:32564273-32564295 CCTTGGGAAACTCTGAGGTGTGG + Intergenic
972606873 4:40621808-40621830 AACAGGGAAGCTCTGAAATGGGG + Intronic
977820582 4:101467866-101467888 CCCTTATAAGCTCTGAGATGTGG + Intronic
978021933 4:103824940-103824962 TCCAGTAAAGCTCTGAGATGAGG + Intergenic
980150111 4:129035705-129035727 CTCTGGAAAGCTATGAGAGGAGG + Intronic
980282383 4:130737819-130737841 CCCTGGGAAGCACTGAGGTCTGG - Intergenic
981355763 4:143787330-143787352 CCCTGGGAAGGAATGAGAAGAGG - Intergenic
981367301 4:143917985-143918007 CCCTGGGAAGGAATGAGAAGAGG - Intergenic
981377087 4:144028218-144028240 CCCTGGGAAGGAATGAGAAGAGG - Intergenic
982133222 4:152248445-152248467 CTCTGGGATGCTTTGAGATTGGG + Intergenic
983979210 4:173973508-173973530 CTCTGGGAAGCTCTGTGAGCTGG + Intergenic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985574849 5:669298-669320 CCCTGGGCAGCTCTGTGGCGTGG + Intronic
986436809 5:7742246-7742268 CCCTCCATAGCTCTGAGATGTGG + Intronic
986643279 5:9892459-9892481 CCCTGGGAAATTCTAAGGTGAGG - Intergenic
986660737 5:10057639-10057661 CCCTGGGAAGATGAGAGTTGGGG - Intergenic
986776730 5:11022282-11022304 CCCTTACAAGCTGTGAGATGTGG - Intronic
987662481 5:20894731-20894753 CCTTGTGAAGCTGTGAGAAGAGG + Intergenic
987967315 5:24893355-24893377 CTTTGTGAAGCTGTGAGATGAGG - Intergenic
991116826 5:62964241-62964263 CCTAGGGAAGCTGTGAGAAGAGG - Intergenic
991546582 5:67788854-67788876 CACTGGGGACCTTTGAGATGGGG - Intergenic
995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG + Intronic
995723808 5:115165236-115165258 CCTAGGGGAGCTCTGAGAAGAGG - Intronic
996416139 5:123212623-123212645 CCATGGGTGGCCCTGAGATGGGG - Intergenic
997527308 5:134561650-134561672 CCCTGGGGAGCTCAGAGGTAGGG + Intronic
998132657 5:139659240-139659262 CCCGGGGAAGGACTGAGGTGGGG + Intronic
1000026589 5:157363976-157363998 CCCTGAGAGGCTCTGAAATGGGG + Intronic
1000515488 5:162232998-162233020 CCCTAGGGAGCTGTGAGAAGAGG + Intergenic
1000639647 5:163686359-163686381 TCCTGGCAAGCTCAGAGAGGAGG + Intergenic
1000978094 5:167786816-167786838 GTTTGGGGAGCTCTGAGATGTGG - Intronic
1001064947 5:168529177-168529199 CCCTGGGAAGGCGGGAGATGGGG + Exonic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1002166418 5:177350295-177350317 CCATGGGAAGGGCTGAGATTAGG + Intronic
1003692150 6:8365397-8365419 CTCTGGGAATCTGTGAAATGGGG + Intergenic
1004017110 6:11742211-11742233 TGCTGAGATGCTCTGAGATGAGG - Intronic
1006579432 6:35068344-35068366 CCTGGGGAAGCTCTGGGGTGGGG + Intronic
1007026091 6:38576252-38576274 CCCTAGGCAGCTCTGAGATATGG + Intronic
1007719970 6:43879103-43879125 CTGTAGGAAGCTCTGAGAGGAGG + Intergenic
1007746917 6:44048641-44048663 CCCTGGGCAGCCATGAGATGGGG + Intergenic
1008410046 6:51166943-51166965 ACCTCAGGAGCTCTGAGATGAGG + Intergenic
1017718035 6:157225579-157225601 CCCTGGGAAACTCAGGGACGAGG - Intergenic
1018420449 6:163636179-163636201 CTCTGGGAGGCTCTGGGCTGGGG + Intergenic
1018835164 6:167477703-167477725 CTGTCAGAAGCTCTGAGATGAGG + Intergenic
1019721856 7:2577165-2577187 CCCAGGGAAGCACTGAGCTGGGG - Intronic
1019857060 7:3619927-3619949 CCCTGGAAAGCTCTGAAGCGTGG - Intronic
1020015936 7:4831955-4831977 CCCTGGGAAGCTCTGAGTTTTGG - Intronic
1022042818 7:26596508-26596530 CCCAGGCAAGCTCTGGGAGGCGG + Intergenic
1022469828 7:30675252-30675274 CCCTGAGGATCACTGAGATGGGG + Intronic
1022704336 7:32788483-32788505 CCCTGGTAAGCAGTGAGAAGTGG - Intergenic
1022908515 7:34878225-34878247 CCCTGGTAAGCAGTGAGAAGTGG - Exonic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1026687089 7:72520343-72520365 CCTTTGGTAGATCTGAGATGAGG + Intergenic
1026687313 7:72522308-72522330 CCTTTGGTAGATCTGAGATGAGG - Intergenic
1029167146 7:98600446-98600468 GCCTCGGAAGCTCTGAAAGGTGG + Intergenic
1029439188 7:100577861-100577883 CCCGGGCCAGCTCTGAGATCCGG + Exonic
1032744779 7:134774636-134774658 CCCTGGGAACCTCTGAGGACAGG - Intronic
1033348318 7:140542131-140542153 CCCCAGGAAGGGCTGAGATGCGG - Intronic
1034452168 7:151142909-151142931 CACTCCGGAGCTCTGAGATGGGG + Intronic
1034900186 7:154903479-154903501 TCCAGAGAAGCTCTGAGATCTGG + Intergenic
1034901578 7:154911031-154911053 CCCTGGGGAGTTCTGGGCTGGGG - Intergenic
1035166527 7:156993578-156993600 CCCTGGGAAGCTCTCCGGGGTGG - Intergenic
1036215735 8:6878244-6878266 CACAGGGAAGCTCTGAGCAGGGG + Intergenic
1036773508 8:11594319-11594341 CACTCAGAAGCTCTGAGAGGAGG - Intergenic
1037390751 8:18389062-18389084 TCATGGGAAACTATGAGATGAGG - Intergenic
1037562317 8:20086061-20086083 CACTGGGAGGGTCTGGGATGGGG + Intergenic
1038049584 8:23796250-23796272 TCCTGGACAGCTCTGAAATGGGG + Intergenic
1038271172 8:26077300-26077322 CCCTGCGAAGGCCTGAGATAAGG + Intergenic
1039603789 8:38864586-38864608 CCCAGGGAAGATTTGAGAAGTGG + Intergenic
1039721800 8:40172788-40172810 CCCAGGGAAGCCCTGGGATTTGG - Intergenic
1040286235 8:46101835-46101857 CCCTGGGAGATTCTGGGATGGGG + Intergenic
1041733304 8:61084585-61084607 GGTTGGGAAACTCTGAGATGGGG + Intronic
1042826656 8:72986450-72986472 CCCTAGGTAGCTTTAAGATGGGG + Intergenic
1043306380 8:78801816-78801838 AGCTGGGAACCTATGAGATGTGG - Intronic
1044085711 8:87939741-87939763 CTCTGGGCAGGTCAGAGATGAGG - Intergenic
1045331751 8:101161496-101161518 CCCTAGGTAGCTTTGGGATGGGG + Intergenic
1046645751 8:116783705-116783727 CCCTGGGAACCCAAGAGATGGGG - Intronic
1047235868 8:123041799-123041821 CCCGGGGAGGCTCTGGGATCTGG - Intronic
1047675660 8:127198634-127198656 CACGAGAAAGCTCTGAGATGAGG + Intergenic
1047924538 8:129669802-129669824 CCCAGTGGAGCTCTGAGAAGAGG + Intergenic
1048267616 8:133001264-133001286 CTCTGCTAAGCACTGAGATGCGG + Intronic
1048893067 8:138965057-138965079 ACCTGGGAAGCTTTGTGCTGGGG - Intergenic
1049005113 8:139850089-139850111 CCCAGGGGAGCACTGAGAAGGGG - Intronic
1049229053 8:141472737-141472759 CCCTGGGAGGATCTGGGAGGAGG + Intergenic
1051697747 9:19788221-19788243 ACCTGGGAATCTCCGTGATGGGG - Intergenic
1051948058 9:22596297-22596319 CTCAGGGAAGATCTGAGACGTGG - Intergenic
1053002414 9:34584595-34584617 GCCTTGGAAGGTCAGAGATGGGG + Intronic
1053556868 9:39146314-39146336 CCATTGGAAGCTCTGCCATGTGG + Intronic
1059334864 9:113562743-113562765 CTCTGAGAAGCACTGGGATGTGG + Intronic
1059441502 9:114309666-114309688 CTCTGGGAAGCTATGAGGGGAGG + Intronic
1060234385 9:121852358-121852380 CCTCGGGAAGCCCTGAGAGGGGG - Intronic
1060824027 9:126677288-126677310 CCCAGGGGAGCTCGGAGAGGAGG - Intronic
1061205635 9:129161556-129161578 TACTGGGAAGGTTTGAGATGGGG + Intergenic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1062444799 9:136589092-136589114 CCCAGGGCAGCTCTGAGCAGGGG + Intergenic
1062633660 9:137478695-137478717 CCCTGAGCAGCCCTGACATGAGG + Intronic
1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG + Intergenic
1187365244 X:18661271-18661293 CCCTTGCATGCCCTGAGATGGGG - Intronic
1189282307 X:39827538-39827560 GCCTCGGCAGCTCTGAGCTGTGG + Intergenic
1190684774 X:52861948-52861970 CCCTAGGTAGCTTTGGGATGGGG - Intergenic
1193360221 X:80572275-80572297 TCTTGAGTAGCTCTGAGATGTGG + Intergenic
1195596729 X:106699621-106699643 CACTGGGGAGTTCTGAGAAGAGG - Intronic
1202352881 Y:24012632-24012654 CCCCGGGAAGTTCTGGGCTGTGG - Intergenic
1202517898 Y:25657483-25657505 CCCCGGGAAGTTCTGGGCTGTGG + Intergenic