ID: 1150210262

View in Genome Browser
Species Human (GRCh38)
Location 17:63437887-63437909
Sequence GGGGGGGACATGCGCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150210262_1150210273 18 Left 1150210262 17:63437887-63437909 CCTGAGATGCGCATGTCCCCCCC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1150210273 17:63437928-63437950 TAGAGACTGCGCCTGAGATGCGG 0: 1
1: 0
2: 0
3: 8
4: 123
1150210262_1150210274 23 Left 1150210262 17:63437887-63437909 CCTGAGATGCGCATGTCCCCCCC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1150210274 17:63437933-63437955 ACTGCGCCTGAGATGCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150210262 Original CRISPR GGGGGGGACATGCGCATCTC AGG (reversed) Intronic
900467349 1:2832299-2832321 GAGGGGGACATGCTCATGCCAGG - Intergenic
902375529 1:16028445-16028467 GGGCGGGCCATGTGCATCTCCGG - Intronic
902869712 1:19306805-19306827 GGGGGGGAAATGAGGATCCCTGG - Intronic
903445275 1:23418896-23418918 GGGGGACACAGGGGCATCTCGGG - Intronic
903805135 1:25999794-25999816 GGTGGTGACATGCCCATCCCTGG - Intergenic
904383559 1:30127295-30127317 GGAGGGGACATACGCATATTTGG + Intergenic
920051649 1:203168022-203168044 GCGGGGGTCTTGGGCATCTCTGG + Exonic
920498060 1:206469439-206469461 GGGTGGAACATGAGGATCTCAGG + Intergenic
922718109 1:227887338-227887360 GGGGGGGAAAAGCCCTTCTCAGG - Intergenic
922745356 1:228040037-228040059 GAGGGGGACATGCCTATCTGTGG - Intronic
1064009919 10:11727577-11727599 GGAGGGGACATGGACAGCTCTGG + Intergenic
1066313549 10:34221225-34221247 GCGGTGGACATGCACATCACCGG - Intronic
1068823146 10:61401641-61401663 GGGTGGGATATGGACATCTCAGG + Intergenic
1068880991 10:62048619-62048641 GGGGAGTACATGTGCTTCTCTGG + Intronic
1073456717 10:103641295-103641317 GAGGGGGACCTGCACAACTCAGG - Intronic
1075182119 10:120220753-120220775 GAGGGGCTCATGGGCATCTCTGG + Intergenic
1077303915 11:1859409-1859431 GAGGGGGACGTGCTCTTCTCTGG - Intronic
1077378426 11:2216276-2216298 GGTGAGGACCTGCGCATCCCAGG - Intergenic
1079079127 11:17401793-17401815 GGGGTGGACAGGAGCATCTGAGG - Intronic
1080604518 11:33853768-33853790 GTGGGGCAGATGAGCATCTCAGG - Intergenic
1083477001 11:62921350-62921372 GGGTGGGACATGCCAATCACTGG - Exonic
1084069973 11:66727927-66727949 GGGGGGGACTCGGGCCTCTCTGG - Intronic
1091275178 11:134344958-134344980 GTGGGGGCCACGCGCATCACAGG - Intronic
1092236168 12:6811115-6811137 GGAGAGGACCTGGGCATCTCAGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1096743351 12:53710324-53710346 GGGGTGGACAGGAGCATTTCAGG + Intronic
1102799536 12:115719438-115719460 GGAGGGCACATGAGAATCTCTGG - Intergenic
1104977802 12:132560064-132560086 GCGGCGGACATGCGCGTCCCCGG + Intronic
1113962475 13:114133234-114133256 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962492 13:114133272-114133294 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962592 13:114133510-114133532 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962610 13:114133549-114133571 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962629 13:114133590-114133612 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962646 13:114133629-114133651 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962662 13:114133668-114133690 GGGGGGGACCTGCTCATGCCGGG - Intergenic
1113962678 13:114133707-114133729 GGGGGGGACCTGCTCATGCCGGG - Intergenic
1113962697 13:114133748-114133770 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1113962731 13:114133828-114133850 GGGGGGGACCTGCCCATGCCGGG - Intergenic
1122341862 14:101033735-101033757 AGGGAGGACGTGCTCATCTCTGG + Intergenic
1124605998 15:31170789-31170811 GGGAGAGACATGCTCCTCTCGGG - Intergenic
1133510135 16:6450098-6450120 GGTGGGGATATGTACATCTCAGG + Intronic
1139446497 16:67001435-67001457 GCGGGGGCCATGAGCATCTCAGG + Exonic
1139633964 16:68246796-68246818 GGGAGAGACGTGAGCATCTCAGG + Intronic
1144542558 17:16158815-16158837 GGAGGGGACACGGGCTTCTCAGG + Exonic
1150210184 17:63437602-63437624 GCGGGGGCTGTGCGCATCTCGGG - Intronic
1150210262 17:63437887-63437909 GGGGGGGACATGCGCATCTCAGG - Intronic
1151663327 17:75531286-75531308 GTGGGAGATCTGCGCATCTCTGG + Intronic
1153148310 18:2058480-2058502 GGGAGGGACATGCCCACCTTAGG + Intergenic
1154032074 18:10762727-10762749 GGGAGGGACAGGCCCATTTCAGG + Intronic
1157475570 18:48021403-48021425 GGGTGGGACATGCGCAACACTGG - Intergenic
1159868993 18:73739591-73739613 GGGGGGGACATCCTCATTTAAGG - Intergenic
1162638196 19:11986889-11986911 GGGAGGAAAATGCGCATCTGCGG - Intergenic
1165172836 19:33906063-33906085 GGCGGGGTCTTGCGCGTCTCCGG + Intergenic
1166313370 19:41975709-41975731 GGGGTGGCCATGGGCATCGCTGG - Exonic
1167359691 19:49023552-49023574 GGGCGGGACATGGGCATCCAAGG - Exonic
1167361440 19:49032533-49032555 GGGCGGGACATGGGCATCCAAGG + Exonic
1167362213 19:49036252-49036274 GGGCGGGACATGGGCATCCAAGG - Exonic
1167363870 19:49044606-49044628 GGGCGGGACATGGGCATCCAAGG + Exonic
1167364628 19:49048321-49048343 GGGCGGGACATGGGCATCCAAGG - Exonic
1167365912 19:49054957-49054979 GGGCGGGACATGGGCATCCAGGG - Exonic
939067797 2:137505327-137505349 GGGAGGGACATGAGCTTCTGTGG + Intronic
942610171 2:177735350-177735372 GGGTAGGCCATGAGCATCTCAGG - Intronic
946083946 2:217152093-217152115 TGGGGTGACATGCCCTTCTCTGG + Intergenic
1169873497 20:10271897-10271919 GGGGGGGAAATGTGTATCTTCGG - Intronic
1170582563 20:17710228-17710250 GGGGGGGACATGGGCAGGGCAGG + Intronic
1171322820 20:24261333-24261355 GAGAGGCACATGCACATCTCTGG + Intergenic
1179710204 21:43208908-43208930 GGGTGGGACGTGTGAATCTCTGG + Intergenic
1183746484 22:39694829-39694851 GGGAGGGGCTTGCCCATCTCAGG + Intergenic
1184016499 22:41789793-41789815 GGGGGAGTCATGAGCTTCTCAGG - Intronic
968801314 4:2744865-2744887 GGGGGCTCCATGCGCAGCTCAGG - Exonic
971191533 4:24433359-24433381 GGGGGGGACAGGCAATTCTCGGG + Intergenic
975648635 4:76569874-76569896 GGAGTGGACATGCTCTTCTCTGG + Intronic
977920192 4:102634688-102634710 GGGGGACACATGCAAATCTCAGG + Intronic
985369027 4:189265641-189265663 GGTGAGGACATCCGCTTCTCAGG - Intergenic
988090056 5:26526874-26526896 GGGGGGAACATCTGCATTTCTGG + Intergenic
1002101275 5:176858918-176858940 GGGGGGGACAGACAGATCTCAGG + Intronic
1002172558 5:177383680-177383702 GGGGAGGACAGGTGCATCCCAGG - Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005640624 6:27792862-27792884 GGGAGGGACCTGCGCACCACGGG - Intergenic
1014747244 6:125214362-125214384 AGGTGGGACATACACATCTCAGG + Intronic
1019578127 7:1747267-1747289 CGGGGCGACAAGCGCATCCCAGG - Exonic
1020099075 7:5384508-5384530 GAGGGGGACATGCGAATGTGAGG - Intronic
1020254949 7:6497799-6497821 GGGGAGGGCCTGCGCAGCTCCGG - Exonic
1029688443 7:102164812-102164834 TCGGGGGACTTGCTCATCTCTGG + Intronic
1032181269 7:129680954-129680976 GGATGGGACCTGCACATCTCTGG - Intronic
1037812534 8:22095467-22095489 GGGGGGGAAAAGCGCACCCCTGG + Intronic
1043015861 8:74940159-74940181 GGGGGGGCCATAAGCACCTCTGG + Intergenic
1049402575 8:142436152-142436174 GGGTGGGCCATGGGCATCTTTGG - Intergenic
1049706423 8:144045283-144045305 GGGAGAGACAGGCGCATCCCAGG + Intronic
1055669961 9:78594981-78595003 GGGGGCTCCATGCCCATCTCAGG + Intergenic
1058270739 9:102968362-102968384 TGGGGGGAGATGGGCTTCTCAGG + Intergenic
1060790333 9:126481623-126481645 GGGTGGGTCGTGTGCATCTCTGG + Intronic
1061499174 9:130992382-130992404 GGGAGGCACATGCACAGCTCCGG - Intergenic
1062337426 9:136078332-136078354 GAGGGGGACAGGCACATCTGGGG + Intronic