ID: 1150211953

View in Genome Browser
Species Human (GRCh38)
Location 17:63446514-63446536
Sequence CCGATCATGGGGGCCCCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150211953_1150211978 30 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211978 17:63446567-63446589 GGAGGGCCGGGAGCTCCCCCGGG No data
1150211953_1150211977 29 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211977 17:63446566-63446588 TGGAGGGCCGGGAGCTCCCCCGG No data
1150211953_1150211969 5 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211969 17:63446542-63446564 CGTGGGATCTGCGGCCTGCGGGG No data
1150211953_1150211972 12 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211972 17:63446549-63446571 TCTGCGGCCTGCGGGGGTGGAGG No data
1150211953_1150211975 18 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211975 17:63446555-63446577 GCCTGCGGGGGTGGAGGGCCGGG No data
1150211953_1150211971 9 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211971 17:63446546-63446568 GGATCTGCGGCCTGCGGGGGTGG No data
1150211953_1150211973 13 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211973 17:63446550-63446572 CTGCGGCCTGCGGGGGTGGAGGG No data
1150211953_1150211970 6 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211970 17:63446543-63446565 GTGGGATCTGCGGCCTGCGGGGG No data
1150211953_1150211967 3 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211967 17:63446540-63446562 TGCGTGGGATCTGCGGCCTGCGG No data
1150211953_1150211966 -4 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211966 17:63446533-63446555 TCGGGGGTGCGTGGGATCTGCGG No data
1150211953_1150211968 4 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211968 17:63446541-63446563 GCGTGGGATCTGCGGCCTGCGGG No data
1150211953_1150211974 17 Left 1150211953 17:63446514-63446536 CCCTCCGGGGCCCCCATGATCGG No data
Right 1150211974 17:63446554-63446576 GGCCTGCGGGGGTGGAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150211953 Original CRISPR CCGATCATGGGGGCCCCGGA GGG (reversed) Intergenic
No off target data available for this crispr