ID: 1150211982

View in Genome Browser
Species Human (GRCh38)
Location 17:63446582-63446604
Sequence GGCCCTCGAGGCAGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150211982_1150211992 13 Left 1150211982 17:63446582-63446604 CCCCCGGGCCTGCCTCGAGGGCC No data
Right 1150211992 17:63446618-63446640 TTGCGAGCCCCGACTGCGCACGG No data
1150211982_1150211993 17 Left 1150211982 17:63446582-63446604 CCCCCGGGCCTGCCTCGAGGGCC No data
Right 1150211993 17:63446622-63446644 GAGCCCCGACTGCGCACGGAAGG No data
1150211982_1150211999 25 Left 1150211982 17:63446582-63446604 CCCCCGGGCCTGCCTCGAGGGCC No data
Right 1150211999 17:63446630-63446652 ACTGCGCACGGAAGGACCTGGGG No data
1150211982_1150211997 23 Left 1150211982 17:63446582-63446604 CCCCCGGGCCTGCCTCGAGGGCC No data
Right 1150211997 17:63446628-63446650 CGACTGCGCACGGAAGGACCTGG No data
1150211982_1150212000 29 Left 1150211982 17:63446582-63446604 CCCCCGGGCCTGCCTCGAGGGCC No data
Right 1150212000 17:63446634-63446656 CGCACGGAAGGACCTGGGGTCGG No data
1150211982_1150211998 24 Left 1150211982 17:63446582-63446604 CCCCCGGGCCTGCCTCGAGGGCC No data
Right 1150211998 17:63446629-63446651 GACTGCGCACGGAAGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150211982 Original CRISPR GGCCCTCGAGGCAGGCCCGG GGG (reversed) Intergenic
No off target data available for this crispr