ID: 1150213641

View in Genome Browser
Species Human (GRCh38)
Location 17:63455102-63455124
Sequence CTGTCTGAGCCGAGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150213638_1150213641 -6 Left 1150213638 17:63455085-63455107 CCTCAGTCTCTGTCCTTCTGTCT 0: 1
1: 0
2: 10
3: 132
4: 1115
Right 1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1150213633_1150213641 30 Left 1150213633 17:63455049-63455071 CCTCCTCTGCTTCTCTGTCACAG 0: 1
1: 0
2: 3
3: 55
4: 476
Right 1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1150213636_1150213641 -1 Left 1150213636 17:63455080-63455102 CCTTCCCTCAGTCTCTGTCCTTC 0: 1
1: 1
2: 10
3: 146
4: 1929
Right 1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1150213634_1150213641 27 Left 1150213634 17:63455052-63455074 CCTCTGCTTCTCTGTCACAGTCT 0: 1
1: 0
2: 5
3: 59
4: 475
Right 1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1150213635_1150213641 0 Left 1150213635 17:63455079-63455101 CCCTTCCCTCAGTCTCTGTCCTT 0: 1
1: 0
2: 3
3: 70
4: 1013
Right 1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1150213637_1150213641 -5 Left 1150213637 17:63455084-63455106 CCCTCAGTCTCTGTCCTTCTGTC 0: 1
1: 0
2: 5
3: 127
4: 872
Right 1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150213641 Original CRISPR CTGTCTGAGCCGAGGTTCTC TGG Intergenic
900831567 1:4969311-4969333 CTCTCTGAGCCCAGGTCCTCAGG + Intergenic
901795512 1:11677213-11677235 CTGTCTGAGCTGAGCCCCTCAGG - Intronic
902232666 1:15037522-15037544 CTGTCAGACCTGAGGTTCCCGGG + Intronic
902684823 1:18069262-18069284 CTGTCTTATCCGGGCTTCTCTGG - Intergenic
903424615 1:23244691-23244713 CTGTCTCAGCCAAGGCTCTAAGG + Intergenic
905866654 1:41380603-41380625 CTCTCTGAGCCTAGGTCTTCTGG + Intronic
907305472 1:53510570-53510592 CTCTCTGAGCCTTGGTTTTCTGG - Intronic
911972484 1:104455005-104455027 CTGTCTGAGATGAAGTTCTCAGG - Intergenic
917942964 1:179941672-179941694 CTGTCTTAGTCAGGGTTCTCCGG - Intergenic
919118435 1:193310418-193310440 CTGCCTGAGCTGAGGTGCCCTGG + Intergenic
1064324847 10:14340360-14340382 CTGGCTGGGCCAAGTTTCTCTGG + Intronic
1069194238 10:65528513-65528535 CTGTCTGAGCAGTGGTCCTCTGG + Intergenic
1070799215 10:79235264-79235286 CCGTGTGAGAGGAGGTTCTCCGG - Intronic
1071446032 10:85748145-85748167 ATGTCTGAGCCCAGGGTCTTTGG - Intronic
1073208388 10:101780501-101780523 CTGTCTGGCCCCAGGTTGTCTGG + Intergenic
1076601618 10:131660525-131660547 GTGTCTGAGCCCAGGCTCTAGGG + Intergenic
1076770502 10:132660621-132660643 GTGTCTGAGCAGAGGCTGTCTGG + Intronic
1078729788 11:13963926-13963948 CTGCCGGAGCCAAGGTTCCCCGG - Intronic
1079241699 11:18726461-18726483 CTCTCTGAGCTGAGGGGCTCAGG + Intergenic
1083353435 11:62047488-62047510 CTGGGTGAGCAGAGGCTCTCTGG - Intergenic
1083654433 11:64222649-64222671 CTGTCTGGGCCTGGGTTCGCCGG + Intronic
1084785232 11:71438176-71438198 CTCTCCCAGCCCAGGTTCTCAGG + Intronic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1091298395 11:134489407-134489429 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298404 11:134489440-134489462 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298413 11:134489473-134489495 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298426 11:134489539-134489561 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298435 11:134489572-134489594 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298450 11:134489638-134489660 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091951239 12:4594606-4594628 CTAGCTGAGCCTAGGGTCTCTGG + Intronic
1092156042 12:6282120-6282142 CTTTCAGAGCCCAGCTTCTCCGG + Intergenic
1104847834 12:131855705-131855727 CTGTCCGAGCCCAGGTGTTCAGG + Intergenic
1111463407 13:88575963-88575985 CTGCCTTAGTAGAGGTTCTCTGG + Intergenic
1113169373 13:107482380-107482402 GTGTATTAGTCGAGGTTCTCTGG - Intronic
1113872055 13:113565501-113565523 GGGTCTGAGCCGAGGGTCTGAGG - Intergenic
1118989086 14:70781820-70781842 CTGTACCAGCCCAGGTTCTCTGG + Intronic
1123031328 14:105452988-105453010 CTGGCTGAGGCCAGGTGCTCAGG + Intronic
1123042786 14:105497203-105497225 CTGCCTGCGCCCAGGTTCTCTGG - Intronic
1125480619 15:40077176-40077198 CTGTTTGAGCCCAGGAGCTCAGG + Intergenic
1125749839 15:42020780-42020802 CTGCCTGAGCCCAGGTCCTTGGG + Intronic
1129753891 15:78084369-78084391 CTGTCTGAGCCTCGGTCCCCTGG - Intronic
1132302674 15:100785763-100785785 CTCTCTGAGCCCAGCTTCTTAGG - Intergenic
1133293796 16:4740178-4740200 CTGTCTGCACCCAGGTTCTGTGG - Exonic
1136055966 16:27689853-27689875 CTGTCCTAGCCAAGGTCCTCAGG - Intronic
1139559169 16:67730720-67730742 CTGGCTGAGCACAGCTTCTCTGG + Intronic
1142359819 16:89620737-89620759 GTGGCTGAGCCGAGGTACTCGGG + Exonic
1146176120 17:30667615-30667637 CTGTCTGCGGCCAGGTCCTCTGG - Intergenic
1146349577 17:32083725-32083747 CTGTCTGCGGCCAGGTCCTCTGG - Intergenic
1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG + Intergenic
1150696970 17:67413896-67413918 TTGTCTAAGCCTAGGTCCTCTGG - Intronic
1151342888 17:73482970-73482992 CTCTCTGAGCCCAGGTCCCCTGG - Intronic
1151846503 17:76659617-76659639 CTGTCTGAGAAGAGGGCCTCAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161496925 19:4591525-4591547 CTGTCTCAGCCCAGGTTCCTTGG - Intergenic
1161560668 19:4970829-4970851 CTGTCTGAGCCGAGGATTTCTGG + Intronic
1162982703 19:14249292-14249314 CTGTCTGCGGCCAGGTCCTCTGG + Intergenic
1164616852 19:29672420-29672442 CTGCCTGAGCTGGGGTTGTCAGG + Intronic
1165382570 19:35491610-35491632 CTGTGTGAGCCATGGTTCTAGGG - Intronic
926140172 2:10363815-10363837 ATCTCTGAGCCTTGGTTCTCTGG + Intronic
930156746 2:48113731-48113753 CAGTCTGAGCCCAGGCTCTGGGG + Intergenic
934653817 2:96107177-96107199 CTGTCTGAGCCTCTGCTCTCTGG + Intergenic
937373527 2:121319392-121319414 TTGTCTGAGCCTGGGGTCTCTGG + Intergenic
937866621 2:126756407-126756429 CTGCCTGAGCTGAGCTCCTCTGG + Intergenic
942136540 2:172931502-172931524 CTGTCTGAGCCAAGTTTATAAGG - Intronic
942306987 2:174618266-174618288 TTGTCTGTGCCGAGCTTTTCAGG - Intronic
946253120 2:218425569-218425591 CTGTGGGAGCCCAGGGTCTCGGG + Intronic
1176122126 20:63458660-63458682 CTGTCTGAGCAGAGGATGTGGGG - Intronic
1179461582 21:41538909-41538931 CTGTATGAGTCCAGGTTCCCAGG - Intergenic
1179545159 21:42108679-42108701 GTGGCTGAGCCGAGGTCGTCAGG - Intronic
1180096401 21:45557239-45557261 CTGTCTGAGCCCCAGTGCTCTGG - Intergenic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1183905930 22:41040155-41040177 CTGTCTGAGGTGAGGCTCTCTGG + Intergenic
950686352 3:14621331-14621353 CTCTCTGAGCGCAGGTTCTGGGG - Intergenic
955873389 3:63463553-63463575 CTGTCAGAGCAGAAGTTCTTAGG + Intronic
961321228 3:126077962-126077984 CCGCCTGGGCCCAGGTTCTCTGG - Intronic
962359916 3:134730239-134730261 CTGTCTGAGCTGAGCCTCTATGG - Intronic
967920124 3:194608305-194608327 CTCTCTCAGCCGAGTCTCTCCGG + Intronic
968344741 3:197992202-197992224 CTGTATTAGTCAAGGTTCTCCGG - Intronic
972245501 4:37243134-37243156 CTGTCTGCCCCCTGGTTCTCAGG + Intergenic
972814460 4:42628845-42628867 CACTCTGAGCTGATGTTCTCAGG + Intronic
978542957 4:109838392-109838414 CTTTCTGAGCAGTGGTCCTCAGG - Intronic
982408062 4:155043272-155043294 CTGTCACAGATGAGGTTCTCTGG - Intergenic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
985069425 4:186153433-186153455 CAGTCTCAGGCAAGGTTCTCAGG - Intronic
990876608 5:60493707-60493729 GTGTGTGAGCCTGGGTTCTCAGG - Intronic
1001003627 5:168030581-168030603 CTGTCTGGGCCGATGGTTTCGGG - Intronic
1001590415 5:172860873-172860895 CAGTCCCAGCCTAGGTTCTCAGG - Intronic
1007032252 6:38639458-38639480 CTGTCTGAGACGACGTTGCCTGG - Intronic
1007070631 6:39035705-39035727 CTGTCTTAGGTGAGGTTCTCTGG + Intergenic
1013325647 6:109044228-109044250 CTGTCTGAGCCAAGGATACCAGG + Intronic
1016515151 6:144884796-144884818 CTGCCTGAGTCGAGGTTCCTTGG - Intergenic
1019022314 6:168929647-168929669 CTGCCTGAGCTGAGGGTCTGTGG + Intergenic
1031832931 7:126649572-126649594 CTGTATTAGTCAAGGTTCTCTGG - Intronic
1032074129 7:128828368-128828390 CTGCCTGTGACGAGGTGCTCAGG - Intergenic
1036707564 8:11056574-11056596 CTGTCTGACCCCAGCTTCCCCGG + Intronic
1040299564 8:46180861-46180883 CTGGGTGAGCCGAGGGACTCAGG - Intergenic
1040928949 8:52714331-52714353 CTGTCAGAGCCGAGGGGCCCAGG + Exonic
1041851815 8:62401796-62401818 CTGTCTGAACTGAGCTTCTAGGG + Intronic
1043018688 8:74972914-74972936 CTGCATGAGATGAGGTTCTCAGG - Intergenic
1045348554 8:101316923-101316945 CTCTCTGAGTTCAGGTTCTCAGG - Intergenic
1045434841 8:102152215-102152237 CTCTCTAAGCCTAGGTCCTCTGG + Intergenic
1047624896 8:126646658-126646680 CTGTATTAGCCAGGGTTCTCTGG + Intergenic
1051330855 9:16023778-16023800 CTGTCACAGCTGAGGTTTTCTGG + Intronic
1053429376 9:38032071-38032093 GGGTCTGGTCCGAGGTTCTCGGG - Intronic
1054993839 9:71361997-71362019 CTAGCTGAGCCTTGGTTCTCTGG - Intronic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1057413789 9:94843450-94843472 GTCTCTGAGCCTTGGTTCTCAGG + Intronic
1060283132 9:122227262-122227284 CTCTCTGAGCCTCGGTTTTCCGG - Intronic
1060851708 9:126882607-126882629 GTCTCAGAGCCCAGGTTCTCAGG - Exonic
1061191794 9:129086451-129086473 CTGTCCTCGCCTAGGTTCTCAGG + Intronic
1061509518 9:131052023-131052045 CTGAGTGAGCAGAGGTGCTCTGG - Intronic
1189220822 X:39370258-39370280 TTCTCTGAGCCTTGGTTCTCTGG - Intergenic
1190492216 X:50993564-50993586 CAGTCAGAGCCCAGGTTCTGGGG + Intergenic
1197653730 X:129093408-129093430 CCTTCTGAGCAGAGGTTCCCAGG - Intergenic
1201716667 Y:17051990-17052012 CTCTCTGAGCCTAAGTTTTCAGG + Intergenic