ID: 1150216958

View in Genome Browser
Species Human (GRCh38)
Location 17:63476551-63476573
Sequence GCCGGGGGTAGGGGTGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216958_1150216972 10 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216972 17:63476584-63476606 CCCGCCCCTCGACCATGGCCTGG No data
1150216958_1150216978 22 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216958_1150216979 27 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216958_1150216969 5 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150216958 Original CRISPR GCCGGGGGTAGGGGTGTGGC GGG (reversed) Intergenic
No off target data available for this crispr