ID: 1150216969

View in Genome Browser
Species Human (GRCh38)
Location 17:63476579-63476601
Sequence ACGTCCCCGCCCCTCGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216955_1150216969 7 Left 1150216955 17:63476549-63476571 CCCCCGCCACACCCCTACCCCCG No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216946_1150216969 26 Left 1150216946 17:63476530-63476552 CCCCGCCTCCCTCCTCTCCCCCC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216959_1150216969 4 Left 1150216959 17:63476552-63476574 CCGCCACACCCCTACCCCCGGCA No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216952_1150216969 14 Left 1150216952 17:63476542-63476564 CCTCTCCCCCCCGCCACACCCCT No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216948_1150216969 24 Left 1150216948 17:63476532-63476554 CCGCCTCCCTCCTCTCCCCCCCG No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216958_1150216969 5 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216963_1150216969 -5 Left 1150216963 17:63476561-63476583 CCCTACCCCCGGCAGGCGACGTC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216964_1150216969 -6 Left 1150216964 17:63476562-63476584 CCTACCCCCGGCAGGCGACGTCC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216961_1150216969 1 Left 1150216961 17:63476555-63476577 CCACACCCCTACCCCCGGCAGGC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216951_1150216969 17 Left 1150216951 17:63476539-63476561 CCTCCTCTCCCCCCCGCCACACC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216949_1150216969 21 Left 1150216949 17:63476535-63476557 CCTCCCTCCTCTCCCCCCCGCCA No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216950_1150216969 18 Left 1150216950 17:63476538-63476560 CCCTCCTCTCCCCCCCGCCACAC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216956_1150216969 6 Left 1150216956 17:63476550-63476572 CCCCGCCACACCCCTACCCCCGG No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216953_1150216969 9 Left 1150216953 17:63476547-63476569 CCCCCCCGCCACACCCCTACCCC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216947_1150216969 25 Left 1150216947 17:63476531-63476553 CCCGCCTCCCTCCTCTCCCCCCC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216962_1150216969 -4 Left 1150216962 17:63476560-63476582 CCCCTACCCCCGGCAGGCGACGT No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216954_1150216969 8 Left 1150216954 17:63476548-63476570 CCCCCCGCCACACCCCTACCCCC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data
1150216965_1150216969 -10 Left 1150216965 17:63476566-63476588 CCCCCGGCAGGCGACGTCCCCGC No data
Right 1150216969 17:63476579-63476601 ACGTCCCCGCCCCTCGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150216969 Original CRISPR ACGTCCCCGCCCCTCGACCA TGG Intergenic
No off target data available for this crispr