ID: 1150216978

View in Genome Browser
Species Human (GRCh38)
Location 17:63476596-63476618
Sequence CCATGGCCTGGTGAAGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216966_1150216978 6 Left 1150216966 17:63476567-63476589 CCCCGGCAGGCGACGTCCCCGCC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216959_1150216978 21 Left 1150216959 17:63476552-63476574 CCGCCACACCCCTACCCCCGGCA No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216968_1150216978 4 Left 1150216968 17:63476569-63476591 CCGGCAGGCGACGTCCCCGCCCC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216956_1150216978 23 Left 1150216956 17:63476550-63476572 CCCCGCCACACCCCTACCCCCGG No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216955_1150216978 24 Left 1150216955 17:63476549-63476571 CCCCCGCCACACCCCTACCCCCG No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216963_1150216978 12 Left 1150216963 17:63476561-63476583 CCCTACCCCCGGCAGGCGACGTC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216965_1150216978 7 Left 1150216965 17:63476566-63476588 CCCCCGGCAGGCGACGTCCCCGC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216962_1150216978 13 Left 1150216962 17:63476560-63476582 CCCCTACCCCCGGCAGGCGACGT No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216970_1150216978 -10 Left 1150216970 17:63476583-63476605 CCCCGCCCCTCGACCATGGCCTG No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216958_1150216978 22 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216953_1150216978 26 Left 1150216953 17:63476547-63476569 CCCCCCCGCCACACCCCTACCCC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216954_1150216978 25 Left 1150216954 17:63476548-63476570 CCCCCCGCCACACCCCTACCCCC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216964_1150216978 11 Left 1150216964 17:63476562-63476584 CCTACCCCCGGCAGGCGACGTCC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216967_1150216978 5 Left 1150216967 17:63476568-63476590 CCCGGCAGGCGACGTCCCCGCCC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data
1150216961_1150216978 18 Left 1150216961 17:63476555-63476577 CCACACCCCTACCCCCGGCAGGC No data
Right 1150216978 17:63476596-63476618 CCATGGCCTGGTGAAGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150216978 Original CRISPR CCATGGCCTGGTGAAGAAGC CGG Intergenic
No off target data available for this crispr