ID: 1150216979

View in Genome Browser
Species Human (GRCh38)
Location 17:63476601-63476623
Sequence GCCTGGTGAAGAAGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216956_1150216979 28 Left 1150216956 17:63476550-63476572 CCCCGCCACACCCCTACCCCCGG No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216967_1150216979 10 Left 1150216967 17:63476568-63476590 CCCGGCAGGCGACGTCCCCGCCC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216961_1150216979 23 Left 1150216961 17:63476555-63476577 CCACACCCCTACCCCCGGCAGGC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216964_1150216979 16 Left 1150216964 17:63476562-63476584 CCTACCCCCGGCAGGCGACGTCC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216970_1150216979 -5 Left 1150216970 17:63476583-63476605 CCCCGCCCCTCGACCATGGCCTG No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216955_1150216979 29 Left 1150216955 17:63476549-63476571 CCCCCGCCACACCCCTACCCCCG No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216959_1150216979 26 Left 1150216959 17:63476552-63476574 CCGCCACACCCCTACCCCCGGCA No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216954_1150216979 30 Left 1150216954 17:63476548-63476570 CCCCCCGCCACACCCCTACCCCC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216962_1150216979 18 Left 1150216962 17:63476560-63476582 CCCCTACCCCCGGCAGGCGACGT No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216958_1150216979 27 Left 1150216958 17:63476551-63476573 CCCGCCACACCCCTACCCCCGGC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216966_1150216979 11 Left 1150216966 17:63476567-63476589 CCCCGGCAGGCGACGTCCCCGCC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216968_1150216979 9 Left 1150216968 17:63476569-63476591 CCGGCAGGCGACGTCCCCGCCCC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216965_1150216979 12 Left 1150216965 17:63476566-63476588 CCCCCGGCAGGCGACGTCCCCGC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216963_1150216979 17 Left 1150216963 17:63476561-63476583 CCCTACCCCCGGCAGGCGACGTC No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216973_1150216979 -7 Left 1150216973 17:63476585-63476607 CCGCCCCTCGACCATGGCCTGGT No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216971_1150216979 -6 Left 1150216971 17:63476584-63476606 CCCGCCCCTCGACCATGGCCTGG No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data
1150216974_1150216979 -10 Left 1150216974 17:63476588-63476610 CCCCTCGACCATGGCCTGGTGAA No data
Right 1150216979 17:63476601-63476623 GCCTGGTGAAGAAGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150216979 Original CRISPR GCCTGGTGAAGAAGCCGGCC AGG Intergenic
No off target data available for this crispr