ID: 1150216991

View in Genome Browser
Species Human (GRCh38)
Location 17:63476641-63476663
Sequence CGCAGGCGCCGCTCGTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216991_1150216996 -9 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150216996 17:63476655-63476677 GCGCCTGCGGACAGCTCCTGGGG No data
1150216991_1150217005 17 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216991_1150217010 28 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150216991_1150217002 14 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217002 17:63476678-63476700 CCCCGGCCTTGTCACTCCGGAGG No data
1150216991_1150217013 30 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150216991_1150217006 18 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217006 17:63476682-63476704 GGCCTTGTCACTCCGGAGGCGGG No data
1150216991_1150217009 27 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217009 17:63476691-63476713 ACTCCGGAGGCGGGAGGCTCCGG No data
1150216991_1150217011 29 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217011 17:63476693-63476715 TCCGGAGGCGGGAGGCTCCGGGG No data
1150216991_1150217008 21 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217008 17:63476685-63476707 CTTGTCACTCCGGAGGCGGGAGG No data
1150216991_1150217000 11 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217000 17:63476675-63476697 GGGCCCCGGCCTTGTCACTCCGG No data
1150216991_1150216995 -10 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150216995 17:63476654-63476676 GGCGCCTGCGGACAGCTCCTGGG No data
1150216991_1150216998 -3 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150216991 Original CRISPR CGCAGGCGCCGCTCGTGCGG CGG (reversed) Intergenic