ID: 1150216998

View in Genome Browser
Species Human (GRCh38)
Location 17:63476661-63476683
Sequence GCGGACAGCTCCTGGGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216991_1150216998 -3 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216988_1150216998 3 Left 1150216988 17:63476635-63476657 CCATCCCCGCCGCACGAGCGGCG No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216982_1150216998 19 Left 1150216982 17:63476619-63476641 CCAGGCCCGATCAGCCCCATCCC No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216981_1150216998 23 Left 1150216981 17:63476615-63476637 CCGGCCAGGCCCGATCAGCCCCA No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216989_1150216998 -1 Left 1150216989 17:63476639-63476661 CCCCGCCGCACGAGCGGCGCCTG No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216983_1150216998 14 Left 1150216983 17:63476624-63476646 CCCGATCAGCCCCATCCCCGCCG No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216987_1150216998 4 Left 1150216987 17:63476634-63476656 CCCATCCCCGCCGCACGAGCGGC No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216993_1150216998 -6 Left 1150216993 17:63476644-63476666 CCGCACGAGCGGCGCCTGCGGAC No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216985_1150216998 5 Left 1150216985 17:63476633-63476655 CCCCATCCCCGCCGCACGAGCGG No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216984_1150216998 13 Left 1150216984 17:63476625-63476647 CCGATCAGCCCCATCCCCGCCGC No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data
1150216990_1150216998 -2 Left 1150216990 17:63476640-63476662 CCCGCCGCACGAGCGGCGCCTGC No data
Right 1150216998 17:63476661-63476683 GCGGACAGCTCCTGGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150216998 Original CRISPR GCGGACAGCTCCTGGGGCCC CGG Intergenic