ID: 1150217003

View in Genome Browser
Species Human (GRCh38)
Location 17:63476679-63476701
Sequence GCCTCCGGAGTGACAAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150217003_1150217016 -2 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217016 17:63476700-63476722 GCGGGAGGCTCCGGGGGGTCGGG No data
1150217003_1150217021 19 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217021 17:63476721-63476743 GGCTGGGAAGATCGAGCCGGAGG No data
1150217003_1150217022 27 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217022 17:63476729-63476751 AGATCGAGCCGGAGGCCGCTAGG No data
1150217003_1150217020 16 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217020 17:63476718-63476740 TCGGGCTGGGAAGATCGAGCCGG No data
1150217003_1150217011 -9 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217011 17:63476693-63476715 TCCGGAGGCGGGAGGCTCCGGGG No data
1150217003_1150217010 -10 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150217003_1150217017 2 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217017 17:63476704-63476726 GAGGCTCCGGGGGGTCGGGCTGG No data
1150217003_1150217015 -3 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217015 17:63476699-63476721 GGCGGGAGGCTCCGGGGGGTCGG No data
1150217003_1150217014 -7 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217014 17:63476695-63476717 CGGAGGCGGGAGGCTCCGGGGGG No data
1150217003_1150217018 3 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217018 17:63476705-63476727 AGGCTCCGGGGGGTCGGGCTGGG No data
1150217003_1150217013 -8 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150217003 Original CRISPR GCCTCCGGAGTGACAAGGCC GGG (reversed) Intergenic
No off target data available for this crispr