ID: 1150217005

View in Genome Browser
Species Human (GRCh38)
Location 17:63476681-63476703
Sequence CGGCCTTGTCACTCCGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216997_1150217005 0 Left 1150216997 17:63476658-63476680 CCTGCGGACAGCTCCTGGGGCCC No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216988_1150217005 23 Left 1150216988 17:63476635-63476657 CCATCCCCGCCGCACGAGCGGCG No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216989_1150217005 19 Left 1150216989 17:63476639-63476661 CCCCGCCGCACGAGCGGCGCCTG No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216987_1150217005 24 Left 1150216987 17:63476634-63476656 CCCATCCCCGCCGCACGAGCGGC No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216993_1150217005 14 Left 1150216993 17:63476644-63476666 CCGCACGAGCGGCGCCTGCGGAC No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216985_1150217005 25 Left 1150216985 17:63476633-63476655 CCCCATCCCCGCCGCACGAGCGG No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216991_1150217005 17 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data
1150216990_1150217005 18 Left 1150216990 17:63476640-63476662 CCCGCCGCACGAGCGGCGCCTGC No data
Right 1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150217005 Original CRISPR CGGCCTTGTCACTCCGGAGG CGG Intergenic