ID: 1150217010

View in Genome Browser
Species Human (GRCh38)
Location 17:63476692-63476714
Sequence CTCCGGAGGCGGGAGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150216989_1150217010 30 Left 1150216989 17:63476639-63476661 CCCCGCCGCACGAGCGGCGCCTG No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150217001_1150217010 -9 Left 1150217001 17:63476678-63476700 CCCCGGCCTTGTCACTCCGGAGG No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150216993_1150217010 25 Left 1150216993 17:63476644-63476666 CCGCACGAGCGGCGCCTGCGGAC No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150216999_1150217010 -2 Left 1150216999 17:63476671-63476693 CCTGGGGCCCCGGCCTTGTCACT No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150217003_1150217010 -10 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150216997_1150217010 11 Left 1150216997 17:63476658-63476680 CCTGCGGACAGCTCCTGGGGCCC No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150216990_1150217010 29 Left 1150216990 17:63476640-63476662 CCCGCCGCACGAGCGGCGCCTGC No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data
1150216991_1150217010 28 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150217010 Original CRISPR CTCCGGAGGCGGGAGGCTCC GGG Intergenic