ID: 1150217013

View in Genome Browser
Species Human (GRCh38)
Location 17:63476694-63476716
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150217001_1150217013 -7 Left 1150217001 17:63476678-63476700 CCCCGGCCTTGTCACTCCGGAGG No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150217003_1150217013 -8 Left 1150217003 17:63476679-63476701 CCCGGCCTTGTCACTCCGGAGGC No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150216991_1150217013 30 Left 1150216991 17:63476641-63476663 CCGCCGCACGAGCGGCGCCTGCG No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150216999_1150217013 0 Left 1150216999 17:63476671-63476693 CCTGGGGCCCCGGCCTTGTCACT No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150216997_1150217013 13 Left 1150216997 17:63476658-63476680 CCTGCGGACAGCTCCTGGGGCCC No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150216993_1150217013 27 Left 1150216993 17:63476644-63476666 CCGCACGAGCGGCGCCTGCGGAC No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data
1150217004_1150217013 -9 Left 1150217004 17:63476680-63476702 CCGGCCTTGTCACTCCGGAGGCG No data
Right 1150217013 17:63476694-63476716 CCGGAGGCGGGAGGCTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150217013 Original CRISPR CCGGAGGCGGGAGGCTCCGG GGG Intergenic