ID: 1150219205

View in Genome Browser
Species Human (GRCh38)
Location 17:63486628-63486650
Sequence TGATAGTGGTGTTCTGCAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150219205_1150219208 -5 Left 1150219205 17:63486628-63486650 CCAGTTGCAGAACACCACTATCA 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1150219208 17:63486646-63486668 TATCAAGCGGATCATAAAGAAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1150219205_1150219210 12 Left 1150219205 17:63486628-63486650 CCAGTTGCAGAACACCACTATCA 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1150219210 17:63486663-63486685 AGAAGGTTCAGGACCTAGAACGG 0: 1
1: 0
2: 1
3: 14
4: 215
1150219205_1150219209 1 Left 1150219205 17:63486628-63486650 CCAGTTGCAGAACACCACTATCA 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1150219209 17:63486652-63486674 GCGGATCATAAAGAAGGTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1150219205_1150219211 13 Left 1150219205 17:63486628-63486650 CCAGTTGCAGAACACCACTATCA 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1150219211 17:63486664-63486686 GAAGGTTCAGGACCTAGAACGGG 0: 1
1: 0
2: 1
3: 5
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150219205 Original CRISPR TGATAGTGGTGTTCTGCAAC TGG (reversed) Exonic
900266706 1:1760798-1760820 TGAGAGTCGTATTCTGCACCTGG - Intronic
904408104 1:30307042-30307064 TTATAATGATGTTTTGCAACTGG + Intergenic
907804983 1:57809975-57809997 TGGTACAGGTGTTGTGCAACAGG - Intronic
907946532 1:59140922-59140944 TAATAGTGGTGTTCTGGAGGAGG + Intergenic
908111698 1:60904516-60904538 TCAAACTGGTGTTCTGAAACAGG - Intronic
919834005 1:201561279-201561301 TGAGAATGGTGATTTGCAACAGG + Intergenic
1063178355 10:3571965-3571987 AGAGATTGGTGTTCTCCAACTGG - Intergenic
1066431702 10:35358146-35358168 TTATGGTGGTGTTCTGTAAAGGG - Intronic
1068874212 10:61979578-61979600 TGGCAGTGGTGTTCTGCAAAAGG - Intronic
1071424731 10:85537849-85537871 TGATACTGGTCTTATGCAAAAGG - Intergenic
1071712886 10:88067008-88067030 TGAAACTCGTGTGCTGCAACAGG + Intergenic
1072766644 10:98099821-98099843 TGACAGTGGTGTTATAAAACTGG - Intergenic
1075275380 10:121088383-121088405 TGACAGTGTTGTTCTGAAAGTGG + Intergenic
1080883554 11:36345134-36345156 TGATGGTTGTGTTCTGCACCCGG + Intronic
1084421517 11:69062919-69062941 TCATAGAGGAGTTCTGCAGCAGG - Exonic
1090955738 11:131511653-131511675 TCATTCTGGTGTCCTGCAACTGG - Intronic
1091067821 11:132533224-132533246 TGATGGTGGTGTTTTACAATAGG + Intronic
1093598161 12:20987016-20987038 TGGTAGTGGTGATCTGGCACTGG + Intergenic
1094311051 12:29083426-29083448 TGACAAAGGTGTTCTGCAATGGG - Intergenic
1094411638 12:30173114-30173136 TGATAGTTGTGTTTAACAACTGG - Intergenic
1097545391 12:60994103-60994125 TGATATTTGTGTGCTGCACCTGG + Intergenic
1097754645 12:63396116-63396138 TGAATTTGGGGTTCTGCAACAGG - Intergenic
1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG + Intronic
1100474506 12:94923103-94923125 TAATTTTGGTGTTCTGCCACTGG - Intronic
1106752875 13:32792828-32792850 TGATAGTGGTTCGCTTCAACCGG + Intergenic
1109367967 13:61382355-61382377 TGAAAGTGGTGTACTGAAACAGG - Intergenic
1111647097 13:91045212-91045234 AGATAGTGGTGTTCTGCAGTGGG - Intergenic
1114148122 14:20002549-20002571 TGACAGTGGTGTAGTGCAGCGGG - Intergenic
1114391390 14:22312312-22312334 GGATAGAGGTTTTCTGCAAGTGG - Intergenic
1117430588 14:55655536-55655558 TGATGGTGGTGTTATGCTAGCGG + Intronic
1119002659 14:70897039-70897061 TGATGACGGTGTTCTGAAACAGG + Intergenic
1125441280 15:39706842-39706864 TGATCATTGTCTTCTGCAACAGG + Intronic
1126406140 15:48324511-48324533 TCATCGTGGTGTTCTGCTAAGGG - Intergenic
1128410446 15:67391689-67391711 TGATACTGATGTTCTCCAAATGG + Intronic
1128953318 15:71911020-71911042 TGATAGAGGAGTTCTAAAACTGG - Intronic
1130560591 15:84955296-84955318 TGGTAGTGGTTTTATGCAACGGG + Intergenic
1132412182 15:101589594-101589616 TGAAACTTGTGTTCTGCAAATGG + Intergenic
1133799705 16:9075075-9075097 TTATAGTAGTGATCTTCAACTGG + Intergenic
1140872107 16:79115933-79115955 TTATTGTGGTGGTCTGGAACGGG - Intronic
1144448074 17:15349959-15349981 TGACAGTGGTGTACTGGAACTGG + Intergenic
1150199129 17:63335150-63335172 TGATAGTGATGTTTTTCTACTGG - Intronic
1150219205 17:63486628-63486650 TGATAGTGGTGTTCTGCAACTGG - Exonic
1155288353 18:24315015-24315037 TTATAGTTGTTTTCTGCAACAGG - Intronic
926433255 2:12812034-12812056 TGTCATTGGTGTTCTGGAACTGG - Intergenic
929190975 2:39139301-39139323 TCAAAGTGTTGTTCTGGAACTGG + Intergenic
929265309 2:39912503-39912525 TAATATTGGTGTTCTGGAAATGG + Intergenic
929639639 2:43564751-43564773 TGATAATGGTGTTCTTCACAGGG - Intronic
938814316 2:134884229-134884251 TGAGTGTGATGTTCTGCAATGGG + Intronic
947601297 2:231452192-231452214 TGATAGTTTTCTTCTGCAAATGG - Exonic
1175223986 20:57434148-57434170 TCATAGTGGTGGTGTGCTACAGG + Intergenic
1175292988 20:57890698-57890720 TGAGGGTGGTGTGCTGAAACTGG + Intergenic
1175423234 20:58849048-58849070 TTATAGTGGTGATTTTCAACTGG + Intronic
1180369209 22:11969053-11969075 TGGGAGTGATGTGCTGCAACCGG + Intergenic
953441764 3:42924655-42924677 TGACAGTGGGTTTCTCCAACAGG + Intronic
956607253 3:71085282-71085304 TGAATGTGGTGTTATGCACCTGG - Intronic
959456664 3:106571373-106571395 TGACAGTGGTGTTCAGAAAATGG + Intergenic
965259543 3:166463497-166463519 AGAAAGTGATGTTCTGGAACAGG + Intergenic
966404399 3:179580326-179580348 AGAAAGTGGTGTTCTGAAATTGG + Intronic
966944178 3:184766079-184766101 TGGTAGTGGTGATCTGGAAGGGG + Intergenic
966986091 3:185181651-185181673 GGAAAGTGGAGTTCTGCAAAAGG + Intergenic
969865799 4:10076344-10076366 AGATAGTTGAGTTCTGCATCTGG - Intronic
970933131 4:21537002-21537024 TCATAGTTGTTTTCTGCCACTGG - Intronic
972347760 4:38207507-38207529 TGATAGAAGTGTTCTTAAACTGG - Intergenic
972558197 4:40201412-40201434 TTACAGTGGTGTTCTAGAACCGG + Intronic
975807435 4:78127471-78127493 TGATAGTGGTGTTAACCAAGAGG + Intronic
977362283 4:96021531-96021553 TGAAAGTGGTTTTATACAACAGG + Intergenic
982443261 4:155460996-155461018 TGATAGGGGTTTTTGGCAACTGG - Intergenic
984339737 4:178441803-178441825 TGGTAGTGATGTTTTGCAATTGG + Intergenic
996255777 5:121401770-121401792 AGAGAGTGGAGTTCTGCTACAGG + Intergenic
996551774 5:124738117-124738139 TGATATTGGTGCCCTGTAACTGG - Intronic
1002627434 5:180540243-180540265 TTGTAGTGATGTTCTGAAACTGG + Intronic
1003681439 6:8261416-8261438 TGATAATGGAGTTCTTAAACTGG - Intergenic
1007290449 6:40782286-40782308 ACATAGTGGTTTTCTGCAAAGGG + Intergenic
1007763854 6:44149849-44149871 TGATGATGGGGTTCTGCAGCAGG - Exonic
1007921554 6:45614808-45614830 TGATTTTGGCTTTCTGCAACAGG - Intronic
1013959465 6:115881632-115881654 TCATACTGTTCTTCTGCAACAGG + Intergenic
1014224020 6:118827521-118827543 TGACAGGGGTGGACTGCAACTGG + Intronic
1014319780 6:119912770-119912792 TTATTGTGGTGGTCTGCAACTGG + Intergenic
1019806691 7:3131622-3131644 TGATAGAAGTGTTCTGAAACTGG - Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1026470566 7:70691680-70691702 AGTGGGTGGTGTTCTGCAACCGG + Intronic
1028378791 7:90175888-90175910 TGAGAGTGGGGTTCAGCCACTGG + Intronic
1028470073 7:91196351-91196373 TTCCAGTGGTGTTCTGGAACTGG - Intronic
1028795545 7:94897760-94897782 TGATAGGGGTGTGCAGAAACTGG - Intergenic
1033004131 7:137542123-137542145 TGATAGGGGTGTGGAGCAACTGG + Intronic
1033766957 7:144504508-144504530 TGATAATGGTGCTCTAAAACTGG - Intronic
1036075359 8:5493497-5493519 CCATAGGGGTGTTCTGCACCTGG + Intergenic
1036979754 8:13456983-13457005 TGAAGGTTGTGTTCTACAACTGG - Intronic
1038027162 8:23602085-23602107 TGACAGTGCAGCTCTGCAACTGG + Intergenic
1040836260 8:51734437-51734459 TGATAGTTGGGTTCTGAAACGGG + Intronic
1057859943 9:98633170-98633192 TGACAGTGGTGTTCTGGAGCTGG - Intronic
1059952852 9:119485365-119485387 TGATAGCGGTTTTCTGCACATGG - Intergenic
1060708340 9:125829871-125829893 TGACAGTGATGTATTGCAACTGG - Intronic
1186845837 X:13530122-13530144 TGATAGAAGTGTTCTTAAACTGG - Intergenic
1187005464 X:15228846-15228868 TGAGATTGGTGATCTGCACCTGG + Intergenic
1187046295 X:15650621-15650643 TGTTTGTGGTCTTCTTCAACAGG + Intronic
1190372953 X:49760728-49760750 TGATAGTGCTACTCTGCCACAGG - Intergenic
1193890766 X:87043690-87043712 TGATAGTACTGTTAGGCAACTGG - Intergenic
1200075877 X:153550448-153550470 TGATGGAGGTGTTTTGGAACTGG - Intronic
1201434519 Y:13942701-13942723 TGGAAGTGTTTTTCTGCAACAGG - Intergenic