ID: 1150220072

View in Genome Browser
Species Human (GRCh38)
Location 17:63491144-63491166
Sequence ACAGACTGCGTGCTGCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150220072_1150220076 -3 Left 1150220072 17:63491144-63491166 CCCCACGGCAGCACGCAGTCTGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1150220076 17:63491164-63491186 TGTCCCCGGAACCCCCAGTTTGG 0: 1
1: 0
2: 1
3: 3
4: 81
1150220072_1150220087 25 Left 1150220072 17:63491144-63491166 CCCCACGGCAGCACGCAGTCTGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1150220087 17:63491192-63491214 ACTCCCTCTGCTTGCAGGGCTGG 0: 1
1: 0
2: 4
3: 32
4: 245
1150220072_1150220077 -2 Left 1150220072 17:63491144-63491166 CCCCACGGCAGCACGCAGTCTGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1150220077 17:63491165-63491187 GTCCCCGGAACCCCCAGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 87
1150220072_1150220086 21 Left 1150220072 17:63491144-63491166 CCCCACGGCAGCACGCAGTCTGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1150220086 17:63491188-63491210 CAGAACTCCCTCTGCTTGCAGGG 0: 1
1: 0
2: 5
3: 12
4: 318
1150220072_1150220085 20 Left 1150220072 17:63491144-63491166 CCCCACGGCAGCACGCAGTCTGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1150220085 17:63491187-63491209 GCAGAACTCCCTCTGCTTGCAGG 0: 1
1: 0
2: 3
3: 17
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150220072 Original CRISPR ACAGACTGCGTGCTGCCGTG GGG (reversed) Intronic