ID: 1150221215

View in Genome Browser
Species Human (GRCh38)
Location 17:63496901-63496923
Sequence GTGCGGAGCCAGTCCAGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221215_1150221220 -3 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221220 17:63496921-63496943 CACGGAGAACGAGCTGCATGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1150221215_1150221221 6 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221221 17:63496930-63496952 CGAGCTGCATGGGGAGAAGCTGG 0: 1
1: 0
2: 1
3: 28
4: 210
1150221215_1150221219 -4 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221219 17:63496920-63496942 GCACGGAGAACGAGCTGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 53
1150221215_1150221222 7 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221222 17:63496931-63496953 GAGCTGCATGGGGAGAAGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1150221215_1150221224 26 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 52
1150221215_1150221223 11 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221223 17:63496935-63496957 TGCATGGGGAGAAGCTGGGCTGG 0: 1
1: 0
2: 5
3: 36
4: 437
1150221215_1150221218 -5 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221218 17:63496919-63496941 CGCACGGAGAACGAGCTGCATGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221215 Original CRISPR GTGCGGAGCCAGTCCAGCAG CGG (reversed) Exonic
900374647 1:2347904-2347926 GTGAGGAGCAAATTCAGCAGCGG - Intronic
900618604 1:3576801-3576823 GTGCAGGGCCAGGCCTGCAGGGG - Intronic
902792501 1:18778684-18778706 GTGTGAAGCCAGTGGAGCAGGGG + Intergenic
904492732 1:30870735-30870757 GTGAGGAGCCAGGCCTGCCGGGG + Intronic
904975074 1:34449664-34449686 GAGCGCAGCCACACCAGCAGTGG - Intergenic
906486610 1:46240278-46240300 GTGCGGAGCCAGGACAGTCGCGG + Intergenic
912553813 1:110501562-110501584 GTGTGGAGCTGGACCAGCAGAGG - Intergenic
913508792 1:119543772-119543794 GTGGAGGGCCAGGCCAGCAGTGG - Intergenic
915142490 1:153776110-153776132 CTGCGGAGGCAGTGCAGCAGGGG - Exonic
915264573 1:154707609-154707631 CAGCGAAGCCAGTCCAGAAGAGG - Exonic
915328577 1:155094059-155094081 GAGGGGAGACAGGCCAGCAGAGG + Intergenic
915913142 1:159926440-159926462 GTGGGGAGCCAGTCAAGGAAGGG - Intergenic
915927137 1:160031486-160031508 GTGAGGAGCCAACCCAGCAGCGG + Exonic
919924952 1:202187404-202187426 CTGCTGAGCCAGCCCTGCAGTGG + Intergenic
920874645 1:209822775-209822797 GTGAGGAGCCAGTCCATGAAAGG - Intergenic
922619021 1:226979391-226979413 GTGCGAGGTCAGCCCAGCAGGGG + Intronic
924004862 1:239598241-239598263 TTTCGCTGCCAGTCCAGCAGAGG + Intronic
924040962 1:239983364-239983386 GTGGGGAGCATGTACAGCAGTGG + Intergenic
924458657 1:244238658-244238680 TTGGGGAGCAAGTGCAGCAGGGG + Intergenic
1063964762 10:11338396-11338418 GTGAGAGGCCAGGCCAGCAGAGG - Intergenic
1064340780 10:14483539-14483561 GGGAGGAGCCAGCCCTGCAGTGG + Intergenic
1069901890 10:71711124-71711146 GTGGGCAGCCATTCCAGGAGGGG - Intronic
1072950166 10:99840324-99840346 GTGCGGAGCCAGGACAGTCGCGG - Intronic
1073295656 10:102436850-102436872 GTGTGGAGCCGGAGCAGCAGGGG - Intergenic
1076482612 10:130794632-130794654 CTGCAGACCCAGTCAAGCAGAGG - Intergenic
1084224149 11:67704698-67704720 GTGTGATGCCACTCCAGCAGTGG - Intergenic
1084270316 11:68026021-68026043 GTGCTGACCCAGACCAGCAGCGG + Exonic
1085266721 11:75241779-75241801 TTGCGCAGCCAGGCCAGCAGGGG - Exonic
1085328091 11:75623994-75624016 ATGTGCAGCCAGGCCAGCAGCGG + Intronic
1085555017 11:77411862-77411884 GAGCGGAGCCGGTGGAGCAGGGG - Intronic
1090583096 11:128181175-128181197 GTGAGGAGCCAGGGCAGGAGAGG + Intergenic
1092833349 12:12465687-12465709 CTGTTGAGCCTGTCCAGCAGGGG - Exonic
1096081491 12:48836139-48836161 GTGGTGATCCAGACCAGCAGAGG + Exonic
1105414142 13:20193947-20193969 GTGCAGAGCCAGCCCCCCAGCGG - Intergenic
1111751364 13:92335329-92335351 GTGCCCAGCCACTCCAGCTGTGG - Intronic
1112336713 13:98522636-98522658 GTGGGAGGACAGTCCAGCAGGGG - Intronic
1120125208 14:80734038-80734060 GAGCATAGCCATTCCAGCAGAGG - Intronic
1121591167 14:95111222-95111244 GTGGGAAGCCAGCCAAGCAGAGG + Intronic
1122079753 14:99258378-99258400 GTGGGGCTCCAGCCCAGCAGGGG - Intronic
1122964064 14:105112894-105112916 GTGCGGAGCCAGGACAGTCGCGG - Intergenic
1123991585 15:25687538-25687560 GTGCAGAGCCAGCCCAGGACAGG + Intronic
1124158660 15:27250117-27250139 GTGGCTGGCCAGTCCAGCAGAGG - Intronic
1127954036 15:63836807-63836829 GTGTGGAGGCAGAGCAGCAGGGG + Intergenic
1129604626 15:77018865-77018887 ATGCTGAGCCAGTGCTGCAGGGG - Intronic
1130460710 15:84156853-84156875 GTGCGCAGCCAGGCCTCCAGTGG + Intergenic
1132767203 16:1540445-1540467 GTGGGAAGCCAGCCCAGCAGGGG - Intronic
1135813859 16:25614114-25614136 CTGCGGAGCCAGCCCAGAAGTGG - Intergenic
1138553589 16:57759868-57759890 GTGGGGAGCCAGGGCAGCCGTGG - Intronic
1144950848 17:18992625-18992647 GGGCGGAGTCGGTCCAGCACCGG + Intronic
1150221215 17:63496901-63496923 GTGCGGAGCCAGTCCAGCAGCGG - Exonic
1151353487 17:73545240-73545262 GGGTTGAGCGAGTCCAGCAGGGG - Intronic
1152537441 17:80959040-80959062 GTGTGGAGCAGGCCCAGCAGAGG + Intronic
1152757841 17:82094370-82094392 GGGCAGAGCCAGCCCACCAGGGG - Intronic
1154121439 18:11655472-11655494 GTTCGGAACGAGGCCAGCAGGGG + Intergenic
1156431949 18:37084942-37084964 CTGTGGAGCCAGCCCAGCACTGG + Intronic
1162498216 19:11035244-11035266 CTGCGGAGCCTGGCCAGGAGTGG - Intronic
1162776634 19:12983733-12983755 GGGAGGGGCCAGGCCAGCAGGGG + Intergenic
1164653382 19:29901900-29901922 GTGCGGAGCCAGGACAGTCGCGG - Intergenic
1165417269 19:35702565-35702587 GAGCGGAGCCAGCCAATCAGCGG + Intergenic
1166261386 19:41644003-41644025 GTGCGGAGCCAGGACAGTCGCGG + Intronic
1168146291 19:54421421-54421443 GTGGGGAGCCCGTCCAGGTGTGG - Intronic
925621106 2:5793763-5793785 TGGGGGTGCCAGTCCAGCAGAGG - Intergenic
926222961 2:10948369-10948391 GTGCGGAGCCACATCAGCAGGGG + Intergenic
926238263 2:11066281-11066303 GTGCTGAGAAAGTCCAGCTGCGG + Intergenic
926545490 2:14234596-14234618 GAGGGGAGAGAGTCCAGCAGTGG + Intergenic
926951217 2:18245655-18245677 ATGTGGAGCCAGCTCAGCAGTGG + Intronic
927981616 2:27378255-27378277 GTTCTGATCCAGTCCCGCAGAGG + Exonic
929435842 2:41927736-41927758 CTGCGGGGCCTGACCAGCAGAGG + Intergenic
930023134 2:47013358-47013380 GTGCTGAGCACGTGCAGCAGAGG + Intronic
932063850 2:68532411-68532433 GTGTGGAGCCTGTGCATCAGTGG + Intronic
937612898 2:123884202-123884224 GATCGGAGCCACTCCATCAGAGG + Intergenic
937905359 2:127050329-127050351 TGGCGGAGACAGGCCAGCAGGGG - Intronic
938068260 2:128293265-128293287 ATGGGGAGCCAGGCCAGAAGAGG - Intronic
945442235 2:209894047-209894069 GTGCTCATCCAGGCCAGCAGAGG + Intronic
946414077 2:219530693-219530715 GTGCGGGGGCATTCCAGGAGAGG + Intronic
946416206 2:219541072-219541094 CTGGGGAGCCAGTGCAGGAGGGG - Exonic
946848203 2:223879831-223879853 GTGAGGACCCAGGCCAGCAAGGG + Intronic
948362489 2:237432861-237432883 GTGGGGAGGCAGGCCAGCAGAGG + Intergenic
948868386 2:240786519-240786541 GGGCAGAGCCAGGCCATCAGGGG + Intronic
1171427370 20:25057490-25057512 GCGCCGAGCAAGGCCAGCAGCGG + Intronic
1172013782 20:31861384-31861406 GTGAGGATGCAGTCCAGCCGTGG - Exonic
1172067644 20:32233094-32233116 GTGCTGGGCCTGGCCAGCAGTGG + Intronic
1172478408 20:35255909-35255931 GTCCAGAGTCAGTCTAGCAGGGG + Intronic
1176109472 20:63404886-63404908 GTGAGGAGACAGCCCAGCGGAGG + Intergenic
1179911234 21:44449973-44449995 GTGTGGAGGCAGGGCAGCAGAGG + Intergenic
1180960087 22:19758647-19758669 GGGCGGAGCCTGGCCAGCCGAGG - Intronic
1183780960 22:39998547-39998569 GTGAGGAAACAGCCCAGCAGGGG + Intronic
1185101620 22:48843692-48843714 GTGTGGAGCGGGTACAGCAGCGG + Intronic
950548514 3:13653067-13653089 GTGCTGAGCCATCCCTGCAGGGG + Intergenic
952436549 3:33277556-33277578 GTGCGGACCCAGCCCGGTAGGGG - Intronic
954126927 3:48536784-48536806 GTGCGGAGATAGGCCAACAGGGG - Intronic
954404557 3:50338096-50338118 CTGCGGAGCCTGGCGAGCAGCGG - Intronic
961130608 3:124463361-124463383 GTGCTGTGCCAGGCTAGCAGAGG + Intronic
968650948 4:1760074-1760096 AGGCAGAGCCAGCCCAGCAGAGG + Intergenic
968754295 4:2407361-2407383 GTATTCAGCCAGTCCAGCAGAGG + Intronic
968894243 4:3389508-3389530 GTGCAGAGCCAGACCAGGAGAGG - Intronic
969388619 4:6874141-6874163 ATGCGCAGCAAGGCCAGCAGGGG - Intronic
974939118 4:68442574-68442596 GTGAGGAGACACTCCAGCTGGGG + Intergenic
980920576 4:139082924-139082946 GTGCGGCGCCACTGCTGCAGCGG - Intronic
982123827 4:152167145-152167167 GTGCAGAGCCAGCCCAGCCATGG - Intergenic
995191498 5:109323044-109323066 GTCAGGAGGCAGTCCTGCAGAGG - Intergenic
998138146 5:139685142-139685164 GGGGGGAGCCTGGCCAGCAGGGG + Intergenic
998555289 5:143117267-143117289 CTGCGGAGCCGGTCCAGCAGAGG - Intronic
998908267 5:146930219-146930241 GTGAGGATCCAGTCAAGCAAGGG + Intronic
1003965688 6:11250174-11250196 GTGGGGAGAAAGACCAGCAGAGG - Intronic
1018778568 6:167042563-167042585 GTGCAGAGGCTGTGCAGCAGTGG - Exonic
1019263076 7:93192-93214 GTGAGGAGCCAGGCCAGCACTGG - Intergenic
1031058888 7:117026797-117026819 GTGGAGAGAGAGTCCAGCAGTGG + Intronic
1034267315 7:149787486-149787508 GTGGGCAGCCAGTTCAGCTGTGG - Intergenic
1034949776 7:155289350-155289372 GAGCAAAGCCATTCCAGCAGAGG - Intergenic
1037885509 8:22594111-22594133 GTGCAATGCCAGTCCTGCAGGGG - Exonic
1039514336 8:38119412-38119434 GTGCTGGGAAAGTCCAGCAGAGG + Intronic
1049208475 8:141374489-141374511 GTGCGGAGACCCTCCTGCAGTGG + Intergenic
1049315284 8:141962940-141962962 GTGAGGAGTCAGTGAAGCAGGGG - Intergenic
1049581795 8:143415375-143415397 GAGAGCAGCCAGTCCAGCTGTGG + Intergenic
1049690866 8:143958275-143958297 GTGGGCATCCAGTCCCGCAGTGG - Intronic
1056451513 9:86721677-86721699 GTCTGCAGCCAGTCCTGCAGGGG + Intergenic
1056792321 9:89633758-89633780 GTGTGGATCCAGGCCAGCTGAGG + Intergenic
1056975237 9:91246915-91246937 CAGCGGAGCCATGCCAGCAGCGG + Intronic
1057829276 9:98394583-98394605 GGGCAGAGCCAGTTGAGCAGGGG - Intronic
1059337060 9:113575539-113575561 GTGGGGAGCCTGTGCAGAAGAGG - Intronic
1060064735 9:120494881-120494903 GTGCGGAGCCAGGACAGTCGCGG + Intronic
1062487753 9:136788925-136788947 GTGCGGACCCACGCCAGCACTGG + Intergenic
1187927520 X:24263530-24263552 GTCCTGAGCCAGTGCAGCTGAGG - Intergenic
1192621036 X:72680662-72680684 GTGCGGAGCCAGGACAGTCGCGG + Intronic