ID: 1150221217

View in Genome Browser
Species Human (GRCh38)
Location 17:63496918-63496940
Sequence CATGCAGCTCGTTCTCCGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221217_1150221224 9 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 52
1150221217_1150221223 -6 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221223 17:63496935-63496957 TGCATGGGGAGAAGCTGGGCTGG 0: 1
1: 0
2: 5
3: 36
4: 437
1150221217_1150221222 -10 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221222 17:63496931-63496953 GAGCTGCATGGGGAGAAGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1150221217_1150221226 23 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221226 17:63496964-63496986 TACAACTGGACGCCGAACTCCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221217 Original CRISPR CATGCAGCTCGTTCTCCGTG CGG (reversed) Exonic
902559354 1:17267364-17267386 ATTGCAGCTCATTCTCCATGGGG - Intronic
903879988 1:26501588-26501610 CCTGGAGCTCTTTCTCCATGTGG - Intergenic
911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG + Intergenic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1064154831 10:12895419-12895441 CATGCAGCTGGTTCTGAGAGTGG + Intergenic
1073287433 10:102397250-102397272 CATGCAGTTCTTTCTTCCTGAGG - Intronic
1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG + Intergenic
1075909930 10:126115433-126115455 CAGTCAGCTCGTTCTCTCTGTGG - Intronic
1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG + Intronic
1082187884 11:49207135-49207157 CAAGCATCTCGTCCTCAGTGTGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1128714043 15:69893956-69893978 CATGCAGCAAGTTCTCCCTGGGG + Intergenic
1131661324 15:94521051-94521073 CATGCAGCTCCTTCTGCACGGGG - Intergenic
1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG + Exonic
1137894961 16:52201628-52201650 CATGCAGTTTGTCCTCAGTGAGG + Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1139745716 16:69072833-69072855 TATTCTGCTCTTTCTCCGTGTGG - Intronic
1142221789 16:88858645-88858667 ACTTCAGCTCGTTCTCCGTAGGG - Exonic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1149936104 17:60808859-60808881 TATGCTGCTCCTTCTCCATGAGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151709216 17:75791501-75791523 AATGTAGCTCGTTCTCACTGAGG - Intronic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1155883698 18:31182242-31182264 CTTGAAGCTCGTTCTCCCTTTGG - Intergenic
1159156427 18:64589188-64589210 CCTGCAGCTGGTTATCTGTGTGG + Intergenic
1165265008 19:34654682-34654704 CATGCAGTTCCTTCTGGGTGGGG - Intronic
1166416898 19:42601851-42601873 CCTGCACCACGTTCTCCGTGTGG + Intronic
1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG + Intergenic
926749753 2:16189336-16189358 CATGCTGCTCCTTCTGCCTGGGG - Intergenic
928696096 2:33851693-33851715 CGTGCAGGTCCTTCTCCCTGGGG - Intergenic
1170854563 20:20039261-20039283 CATCCCCCTCGTTCTCCGGGTGG + Intronic
1172694896 20:36815779-36815801 CGTCCAGCTCGTGCTCCGAGCGG + Exonic
1175391785 20:58632145-58632167 CATGGAGCTCCTTCTCAGTGGGG - Intergenic
1175749329 20:61484418-61484440 GATGCAGCTCGTGCCCAGTGAGG - Intronic
1181066344 22:20307812-20307834 CATGGAGCTGGCTCACCGTGAGG + Intergenic
952803963 3:37328362-37328384 CTTGCAGCTTGTTCTTTGTGTGG + Intronic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
975441767 4:74419470-74419492 CATGAACCTGGTTCTCCTTGTGG + Intergenic
987416817 5:17670784-17670806 CAGGCTGCTCGTTCGCCCTGTGG + Intergenic
999326571 5:150647963-150647985 CTTTCAGATCCTTCTCCGTGAGG - Exonic
999442877 5:151616088-151616110 CATGCACATCGTTCTGCCTGAGG + Intergenic
1002018559 5:176346689-176346711 CTTGCAGCTAGTTCTTCATGTGG - Exonic
1005681954 6:28216927-28216949 CATGCAGCCTCTTCTCCCTGGGG - Intergenic
1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG + Intergenic
1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG + Intronic
1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG + Intergenic
1029975216 7:104827196-104827218 CCTGCAGCCAGTTCTCCATGTGG + Intronic
1030358598 7:108570206-108570228 CATGCAGCCCATTGTCCCTGCGG - Intronic
1032069383 7:128794487-128794509 CCTCCAGCTCTGTCTCCGTGAGG - Exonic
1037328105 8:17715232-17715254 CATGCAGCTTTGTCTCAGTGGGG - Intronic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1056379711 9:86046359-86046381 CATGCACCTTCTGCTCCGTGCGG - Intronic
1061612714 9:131758755-131758777 CATGGAGCTCATGCTCCGTCTGG - Intergenic
1061623001 9:131823922-131823944 CAGACAGCTCTTTCTGCGTGGGG + Intergenic
1186979503 X:14944209-14944231 AATGCAGCTCGTTCTCAGGATGG + Intergenic
1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG + Intronic