ID: 1150221222

View in Genome Browser
Species Human (GRCh38)
Location 17:63496931-63496953
Sequence GAGCTGCATGGGGAGAAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221212_1150221222 27 Left 1150221212 17:63496881-63496903 CCATGTTGAGCTACTTCAAGCCG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1150221222 17:63496931-63496953 GAGCTGCATGGGGAGAAGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1150221217_1150221222 -10 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221222 17:63496931-63496953 GAGCTGCATGGGGAGAAGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1150221215_1150221222 7 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221222 17:63496931-63496953 GAGCTGCATGGGGAGAAGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221222 Original CRISPR GAGCTGCATGGGGAGAAGCT GGG Exonic
901813720 1:11782126-11782148 GAGGCCCATGGGGAGAGGCTGGG + Intronic
902389205 1:16092927-16092949 GATCTGCCTGGGGACCAGCTGGG + Intergenic
902784869 1:18726485-18726507 GAGCTGCCTGGGGACAGACTTGG - Intronic
903779467 1:25811911-25811933 AGGCTGCATGGGCAGAGGCTGGG + Intronic
904405712 1:30286755-30286777 AAGCTGCAGGGAGAGAAGCCTGG - Intergenic
905921955 1:41725551-41725573 AAGATGAATGGGCAGAAGCTGGG + Intronic
906513463 1:46424436-46424458 GAGCTGAATGGGGTGGAGGTAGG - Intergenic
907270919 1:53290717-53290739 CTGCTGCTTGGGAAGAAGCTGGG - Intronic
907313299 1:53552194-53552216 GAGCTGGTAGGGGAGAGGCTAGG - Intronic
907554466 1:55332665-55332687 GAGATGCCAGGAGAGAAGCTAGG + Intergenic
908037683 1:60073734-60073756 CAGCTTCCTGGGGAGAAGCACGG - Exonic
908337297 1:63139835-63139857 GAGCTTCATGGGGAAGAGTTTGG - Intergenic
908673645 1:66576891-66576913 GCTCTGCTTGGGGAGAAGGTGGG - Intronic
909553599 1:76928033-76928055 GAGCTTGATGGGGACAATCTGGG + Intronic
910036583 1:82796275-82796297 GAGCTGGAAGGGGAGAAGGAAGG + Intergenic
912206607 1:107515991-107516013 GGCCTGCATGAGGAGAAGGTGGG - Intergenic
912451020 1:109767847-109767869 AAGCGGCCTGGGGAGAAGATGGG + Intronic
912527233 1:110292417-110292439 GATGTGAATGGGGAGAAGCTGGG - Intergenic
912708700 1:111934101-111934123 GAACCACACGGGGAGAAGCTCGG - Intronic
914342553 1:146772852-146772874 AAGCAGCAGGGGGAGCAGCTGGG - Intergenic
917796839 1:178538779-178538801 GGGCTGCAGAGGGGGAAGCTGGG - Intronic
918420992 1:184364017-184364039 GGGCTGCATGGTGCCAAGCTCGG - Intergenic
919866062 1:201783766-201783788 GAGCAGCAGGGGGAGCAGGTGGG - Exonic
920054206 1:203180928-203180950 GGGCCGAATGGGGAGAGGCTGGG - Intronic
923229423 1:231970504-231970526 TAGCTGCATGGGAAGAATCTGGG + Intronic
924063174 1:240197293-240197315 GAGATGGATGGGGAGAGGCTTGG - Intronic
924424254 1:243936161-243936183 GGGCTGCATGGTGAGTGGCTGGG + Intergenic
1062787286 10:275792-275814 GAGCTGCCAGGGCAGAAACTGGG + Exonic
1062938659 10:1406210-1406232 GACCTGCAAGGAGAGCAGCTGGG - Intronic
1063455315 10:6178635-6178657 GAGATGACTGGGGAGCAGCTGGG + Intronic
1063597737 10:7452311-7452333 GAGACGAATGAGGAGAAGCTGGG - Intergenic
1065776654 10:29126547-29126569 GAGCTGCAGGAGGAGTAGCTGGG + Intergenic
1067228497 10:44390704-44390726 GAGCTGCATGCCAGGAAGCTGGG + Intergenic
1067557356 10:47282302-47282324 GGGCTGCATTGGGAGGGGCTTGG - Intergenic
1069573034 10:69506104-69506126 ACGCTGCATGGGAAGGAGCTGGG - Exonic
1072740584 10:97906743-97906765 GAGCTGAATGGCAAAAAGCTGGG + Intronic
1073013787 10:100382287-100382309 GAGCAGCCTGGGGAGAAGGGGGG - Intergenic
1073467760 10:103704279-103704301 GAGCAGCATGGGAAGAAGCAGGG + Intronic
1073544107 10:104334762-104334784 GAGCAGCATGGGGTGAGGGTGGG - Intronic
1073566902 10:104542879-104542901 GAACTGCAAGGGGGTAAGCTGGG + Intergenic
1074157614 10:110812345-110812367 GAGCTGCAGGAGGTGAAGCTGGG - Exonic
1074239490 10:111622760-111622782 GAGGTTCATGAGAAGAAGCTGGG + Intergenic
1075398358 10:122143578-122143600 GACCCGCATGGGCAGCAGCTGGG - Exonic
1075494442 10:122907710-122907732 GATCTGCAAGGTGAGAAGCCAGG - Intergenic
1075573410 10:123561115-123561137 GAGCTGCATGGAGAGAGGCATGG - Intergenic
1075841582 10:125509135-125509157 GAGAAGCATGAGGTGAAGCTGGG + Intergenic
1077451555 11:2651279-2651301 GAGCTTCATGGTGGGCAGCTGGG + Intronic
1077468151 11:2743505-2743527 GAGCTGCATGCCGGGGAGCTGGG - Intronic
1078067256 11:8086593-8086615 GAGCTGCAAGGGGACGAGATGGG - Intronic
1078141910 11:8699208-8699230 GAGCTGCCTGTGGAGGAGGTGGG - Exonic
1078567484 11:12429092-12429114 CAGCTACTTGGGAAGAAGCTGGG - Intronic
1083624183 11:64063660-64063682 GTGCTGGATGGGCAGAAGCCTGG + Intronic
1084093436 11:66894377-66894399 GACTTGCATGGGCAAAAGCTGGG - Intronic
1084323418 11:68385892-68385914 GAGCAGCATGGCCAGCAGCTGGG + Intronic
1084857016 11:71995948-71995970 GAGCTGAATGCAGAGAAGGTGGG - Intronic
1085717149 11:78882361-78882383 GAGCAGCATGGGCAAAAGCATGG - Intronic
1087037980 11:93773438-93773460 GAGCAACATGGGGCCAAGCTGGG - Intronic
1087224498 11:95582870-95582892 GAGAGGCATGGGCAGAAGCAAGG - Intergenic
1088507698 11:110542270-110542292 GAGCTGCTTGGGGAGTTGGTGGG + Intergenic
1089467365 11:118694005-118694027 TTGCTGCATGGGGTGAAACTTGG - Intergenic
1089611347 11:119671247-119671269 GAGCTGCAAGGGCCGCAGCTGGG + Intronic
1089792135 11:120953020-120953042 GAACTGCATGGGGAGGGGGTGGG + Intronic
1091172580 11:133531667-133531689 GAGCTCCAGGGGGAGAGGGTAGG + Intronic
1091657110 12:2353825-2353847 GAGCTGTGTGGGGAGAGGCAGGG + Intronic
1091812966 12:3415205-3415227 GAGATGCATGGGGCGAGGCATGG + Intronic
1096620070 12:52858878-52858900 GAGCTGCAGAGGCAGCAGCTTGG - Intergenic
1096799551 12:54101082-54101104 TAGCTGGAGGGGGAGAATCTGGG - Intergenic
1097269118 12:57763643-57763665 CAGCTGTATGGGGAGACGCCTGG - Exonic
1097911059 12:64969545-64969567 TAGCTGAACTGGGAGAAGCTTGG - Intergenic
1098007918 12:66018882-66018904 GAGTTGCATGAGGAGCATCTTGG + Intergenic
1099161039 12:79242186-79242208 GAGCTGCATGTGGATCACCTGGG + Intronic
1100745942 12:97645866-97645888 GAGCTGCCTATGGAGAGGCTTGG + Intergenic
1101780679 12:107832317-107832339 GAGCTGCATGGAGAACAGCAAGG - Intergenic
1101803727 12:108045374-108045396 GAGATGCCTAGGGAGAAACTTGG - Intergenic
1101840066 12:108321747-108321769 GGGCTGTGTGGGGAGGAGCTAGG - Intronic
1103058549 12:117840684-117840706 CAGCTGCATGGGGACAGGCGTGG - Intronic
1103199146 12:119072366-119072388 TGGCTGCCTGGGGAGAAGGTAGG - Intronic
1103718156 12:122958416-122958438 TAGCTGCATAAGGAAAAGCTGGG + Intronic
1103726106 12:122998112-122998134 GAGCTGCAGGCAGAGTAGCTGGG - Intronic
1104108723 12:125686938-125686960 AAGCTGCATGGGCAGAATCCAGG + Intergenic
1104355001 12:128077501-128077523 GAGATGCATAGAGAGAAGCCAGG - Intergenic
1104710472 12:130982214-130982236 GAGGTGCATGGGGAGAGGCAAGG + Intronic
1104895369 12:132161238-132161260 GAACTGAGTGGGGAGGAGCTGGG - Intergenic
1105804752 13:23946490-23946512 GAGCTGCAGGGGGAGGAATTGGG - Intergenic
1106393690 13:29359956-29359978 GAGCAGCATGGGGTGAGGTTCGG + Intronic
1108689504 13:52848386-52848408 GAGCTGCAAGGGGAAAAGGCAGG + Exonic
1109326240 13:60870601-60870623 GAGGTGAAGGGGAAGAAGCTGGG - Intergenic
1112492637 13:99880989-99881011 GAGCAGCATGCTGAGCAGCTGGG - Intronic
1112940952 13:104861221-104861243 GAGCTGCAAAAGGAGAACCTGGG + Intergenic
1113582782 13:111440586-111440608 GAGCTGCAGGGGGAGCTGCAGGG - Intergenic
1113582786 13:111440598-111440620 GAGCTGCAGGGGGAGCTGCAGGG - Intergenic
1113582790 13:111440610-111440632 GAGCTGCAGGGGGAGCTGCAGGG - Intergenic
1113582801 13:111440646-111440668 GAGCTGCAGGGGGAGCTGCAGGG - Intergenic
1113730318 13:112636996-112637018 GTGCCACATGGGGACAAGCTGGG - Intergenic
1114046769 14:18882235-18882257 AAGCTGCATGAGGAGTGGCTGGG + Intergenic
1114117444 14:19637211-19637233 AAGCTGCATGAGGAGTGGCTGGG - Intergenic
1119543540 14:75456049-75456071 GACCTCCAAGGGTAGAAGCTTGG + Intronic
1119651514 14:76387226-76387248 GAGGTGAATGAGGGGAAGCTGGG - Intronic
1120735509 14:88047681-88047703 CAGCTGCTTGGGAAAAAGCTGGG - Intergenic
1120964663 14:90156790-90156812 GAGCACCATGGGGAAAAGCAGGG - Intronic
1121837851 14:97108043-97108065 GAGCTCCATGAGGAGAAGGAAGG + Intergenic
1122228178 14:100291730-100291752 CAGTGGCATGTGGAGAAGCTGGG + Exonic
1122640421 14:103156176-103156198 GGCCTGCATGGGGTGAAGCTAGG - Intergenic
1202902853 14_GL000194v1_random:53227-53249 GAGGTGCAGGGGGAGGAGTTGGG + Intergenic
1123439655 15:20281271-20281293 GGGCTGCCTGGGGAGGAGCGGGG + Intergenic
1124016066 15:25876977-25876999 GAGCTACGTAGGGCGAAGCTAGG + Intergenic
1125300674 15:38251868-38251890 GAGCTGCGAGGGGAGCTGCTAGG - Intergenic
1127142336 15:55990731-55990753 GAGGTGCATGGGAAGGAGGTGGG + Intronic
1127546270 15:59996704-59996726 GCGCTGCAGGGGGGGATGCTGGG + Intergenic
1128876873 15:71208959-71208981 GCCCTGCATGGGGTGAGGCTAGG - Intronic
1129228750 15:74184816-74184838 GCGCTGCAGTGGGAGAAGGTGGG - Intronic
1129419505 15:75412792-75412814 GAGCTGGCTGGGCAGGAGCTGGG + Exonic
1129466738 15:75728324-75728346 AAGATGCTTTGGGAGAAGCTCGG + Intergenic
1130063576 15:80587001-80587023 GAGCTTTATGGGCAGGAGCTGGG - Intronic
1130609129 15:85344662-85344684 GACCTGCCTGGGGAGCAGGTAGG + Intergenic
1132556596 16:575383-575405 GTGCCCCATGGGGAGCAGCTAGG + Intronic
1132670585 16:1100773-1100795 GAGGTGCAGGGGGAGGAGGTGGG + Intergenic
1133028179 16:2997637-2997659 GGGCGGCATGGGGAGAGGTTGGG - Intergenic
1133279465 16:4657042-4657064 GAGCTGCATGGTGAGCAGAGAGG + Intronic
1133775813 16:8894333-8894355 GATCTTCAAGGAGAGAAGCTTGG - Intronic
1134882585 16:17758696-17758718 TAGCAGCATGGGGAGATGGTGGG - Intergenic
1135839997 16:25867369-25867391 GAGCTGGAAGGGGAGAAATTAGG + Intronic
1136573573 16:31110482-31110504 GCGCTGCATGAGGACAAGGTGGG + Exonic
1137767314 16:50987899-50987921 GAGCAGGATGGGGAGATGCTTGG - Intergenic
1138105443 16:54285180-54285202 GAGCTGGAGGAGGAGGAGCTCGG - Exonic
1138496992 16:57415061-57415083 GAGCTGCAGGGAGAGGAGCGGGG - Exonic
1139407096 16:66727717-66727739 GACGTGCCTGGGGAGGAGCTAGG + Exonic
1139949236 16:70661117-70661139 CAGCTGCAGGGGGACAGGCTGGG - Intergenic
1139970330 16:70770284-70770306 GAGCAGCATGTGGAGAAAGTTGG - Intronic
1140201354 16:72897297-72897319 GAGAGGGATGGGGAGAAGATGGG + Intronic
1140741703 16:77947481-77947503 GCCCTGGATGGGGAGAAACTGGG - Intronic
1141091464 16:81133242-81133264 GAACTGCCTGGGCAGAAGCCTGG + Intergenic
1141882757 16:86870769-86870791 GGGCTGCATTGTGAGAAGGTGGG - Intergenic
1142280244 16:89144284-89144306 GAACTGCACGGGGAGGAGCAAGG + Intronic
1142307477 16:89293664-89293686 GGGCTGCAGAGGGAGGAGCTGGG + Intronic
1143283954 17:5775172-5775194 GCGCAGCATGGGCAGGAGCTCGG - Intronic
1143340037 17:6203642-6203664 GAGATGCAAGGAGAGATGCTGGG - Intergenic
1144944412 17:18962428-18962450 GAACAGCGTGGAGAGAAGCTGGG + Intronic
1145198024 17:20912903-20912925 TTGCTGCATGGGGTGAAGCCCGG + Intergenic
1146126802 17:30237156-30237178 GGGGTGCATGGGGGGATGCTGGG + Intergenic
1147647502 17:42042733-42042755 CAGCTCCTTGGGGAGCAGCTAGG - Intronic
1147759135 17:42786339-42786361 AAGATGCAAGGGCAGAAGCTTGG + Intronic
1148200023 17:45744034-45744056 CAGCTGCAGGGAGAGAGGCTTGG - Intergenic
1148206433 17:45783192-45783214 GAGCTGAAAAGGGAGAAACTGGG - Intergenic
1149568313 17:57654636-57654658 GAGCATCCTGGGGAGGAGCTGGG - Intronic
1149895105 17:60422985-60423007 GAGGTGCATGGAGAGGAGATGGG - Intronic
1150221222 17:63496931-63496953 GAGCTGCATGGGGAGAAGCTGGG + Exonic
1152069567 17:78128137-78128159 GAGCTAGGTGGGGAGAGGCTGGG + Intronic
1152163335 17:78683555-78683577 GAGCTGAGTGAGGAGAAGCTGGG + Intronic
1152317523 17:79589652-79589674 GAAATGCACGGGGAGGAGCTGGG + Intergenic
1152598612 17:81250349-81250371 GAGCTGCACCTGGAGAAGCCAGG + Intronic
1154106032 18:11523817-11523839 GAGAGCCATGGGGAGCAGCTGGG - Intergenic
1157474271 18:48011430-48011452 GATCTGCATGGGCCCAAGCTCGG - Intergenic
1157493467 18:48139436-48139458 GAGCCGCCTGGGGGTAAGCTGGG - Intronic
1159505237 18:69327806-69327828 GAGCTGCTTGGGGAAATGGTAGG + Intergenic
1160525447 18:79532980-79533002 CATCTGGATGGGGAGGAGCTGGG + Intergenic
1160968044 19:1755147-1755169 GGGCTGCTTGGGGAGAGGCTCGG - Intronic
1161317390 19:3623977-3623999 GAGCTGGATGCTGAGGAGCTAGG + Exonic
1161605798 19:5214274-5214296 GAGCTCCCTGGGTAGAAGCTGGG + Intronic
1161818764 19:6516431-6516453 GCGGGGCCTGGGGAGAAGCTAGG + Intergenic
1162548996 19:11348120-11348142 GAGCAGCATGTGCAAAAGCTTGG - Intronic
1162554836 19:11380438-11380460 GAACAGCATGGGCAAAAGCTTGG + Intronic
1163644767 19:18482899-18482921 CAGCTGCTTGGGGATAAGGTGGG - Intronic
1164686913 19:30172655-30172677 GGGCTTCAAGGGGACAAGCTAGG + Intergenic
1165227609 19:34365653-34365675 GAGCTGCACGGGGAGGAGGAGGG - Intronic
1165397874 19:35577050-35577072 GAGGTCCCTGGGGAGAAGCAGGG + Intergenic
1166148524 19:40853465-40853487 CAGCTCCATGGGGTAAAGCTTGG - Intronic
1166152663 19:40885250-40885272 CAGCTCCATGGGGTAAAGCTTGG - Intronic
1166930050 19:46296985-46297007 GCGCGGCGTGGGGAGGAGCTGGG + Intergenic
1167219239 19:48186763-48186785 GAGCTGCAGGGGCAGAGGCAGGG + Intronic
1167382862 19:49148810-49148832 GAGCTGGATGGGGAGGAGAGGGG + Intronic
1167660750 19:50794672-50794694 GAGCTGCATGGGATGATGCTGGG + Intronic
1167753499 19:51395078-51395100 GGGCTGAGAGGGGAGAAGCTGGG - Intergenic
1168246142 19:55114005-55114027 GGTCTGAATGGGGAGAGGCTGGG - Intronic
1168578600 19:57534765-57534787 GAGTGGCATGTGGAGAAGCCAGG + Intronic
1168712451 19:58509679-58509701 GGGCCGCATGGACAGAAGCTTGG - Intronic
925049139 2:797615-797637 GAGGGGCAGGGGCAGAAGCTGGG + Intergenic
925209650 2:2035170-2035192 GAGATGGTTGGGGAGAAGTTAGG - Intronic
925209661 2:2035223-2035245 GAGATGGTTGGGGAGAAGTTAGG - Intronic
925944400 2:8847203-8847225 GAGCTGCATGGGGGATAGCAAGG + Intergenic
926518460 2:13879562-13879584 TAGCTACATGGGGAAAAGTTTGG - Intergenic
926950692 2:18240136-18240158 GAGCTTCACTGGGAGAAGCCAGG - Intronic
927200839 2:20577246-20577268 GAGCTGAGTGGGGAGAGGGTGGG + Intronic
927464972 2:23329919-23329941 GAGCTGCAGGGGCAGAAGTGTGG - Intergenic
927888675 2:26734504-26734526 GAGCTGCAAGGGAGGGAGCTTGG - Intergenic
928317720 2:30258831-30258853 GAACAACATGGGGAGAAGCCAGG - Exonic
929014949 2:37484798-37484820 GAGGTACAAGGGGAGAAGATAGG + Intergenic
929244479 2:39686668-39686690 GGGCAGGATGGGGAGAAGATGGG + Intronic
929418070 2:41764078-41764100 GAGATGCAAGGGTAGAAGCCAGG + Intergenic
929530765 2:42750660-42750682 GAGCTTCATGGGAAGAAGGCTGG + Intronic
929788457 2:45008052-45008074 GACCTGGATGGGGAAAAGCCAGG - Intronic
931389638 2:61830347-61830369 CAGCTGAATGGGGAGGAACTGGG + Intronic
931426676 2:62178071-62178093 CAGATGCATGGGTAGCAGCTGGG - Intergenic
933820656 2:86108656-86108678 TAGCTGAGCGGGGAGAAGCTAGG + Intronic
934025527 2:87998919-87998941 GAGATGCATGGGGTGAGGTTTGG - Intergenic
934503806 2:94877167-94877189 GAGGTGCAGGGGGAGGAGTTGGG - Intergenic
935437968 2:103056943-103056965 AAGCTGCATGGGGAGAGGGAAGG + Intergenic
935711426 2:105902359-105902381 GAGCTGAATGGGGAGGAAGTTGG - Intergenic
936944422 2:117917713-117917735 GAGGTGCGTGGGGAGATGCTAGG - Exonic
937273761 2:120671423-120671445 GAGCCGCTTGGGGAGCAGCGGGG - Intergenic
938244661 2:129767308-129767330 GGGCTGCCTGGGGAGAGGCTGGG - Intergenic
939099088 2:137873662-137873684 GAGCTGCCTGGCAACAAGCTCGG + Intergenic
939170096 2:138685818-138685840 GAGCAGCATGGAGAGACACTTGG - Intronic
939863879 2:147450925-147450947 GAACAGAATGCGGAGAAGCTGGG + Intergenic
942602128 2:177652347-177652369 GAGTTGCATGGGGAGAGGAGGGG + Intronic
943018564 2:182545277-182545299 GGGCTGCTTTGGGAGAAGCTGGG - Intergenic
945019654 2:205557979-205558001 CACCTGCATGGGGATATGCTGGG + Intronic
946130123 2:217600219-217600241 GAGTTCTATGGGGAAAAGCTAGG - Intronic
947636890 2:231684761-231684783 GAGCTTCATGGGGAGCAGGGAGG + Intergenic
948423933 2:237876353-237876375 GAGCTGCCCTGGGAGACGCTGGG - Intronic
948767351 2:240230030-240230052 CAGCTGCAGGTGGAGAGGCTGGG + Intergenic
948867172 2:240782106-240782128 AAGCTGCCTGGGGCGACGCTGGG - Intronic
948897441 2:240934005-240934027 GTGCAGCCTGGGGAGAAGCCTGG - Intronic
949046398 2:241874449-241874471 GAACTGCCTGGGGAGACCCTGGG + Intergenic
1169682037 20:8226423-8226445 GACATGAATGAGGAGAAGCTGGG + Intronic
1170415346 20:16133519-16133541 AAGCTGCATGTGGAGAAGGTTGG - Intergenic
1170454206 20:16517497-16517519 AAGCTGAATGGGGAGAAGTCAGG + Intronic
1171796879 20:29573263-29573285 TAGCTGGAGGGGGAGAATCTTGG + Intergenic
1171851369 20:30310900-30310922 TAGCTGGAGGGGGAGAATCTTGG - Intergenic
1173474418 20:43348939-43348961 CAGAAGCATGGGGAGGAGCTGGG - Intergenic
1174263486 20:49314509-49314531 GAGCTGGGTGGGGAGAAGGAAGG - Intergenic
1174383492 20:50172393-50172415 GAGCTGCAGAGGGCGGAGCTTGG - Intergenic
1174873638 20:54206020-54206042 GAGCAGCATGGAGCGAGGCTGGG - Intergenic
1175513040 20:59547514-59547536 GAGCTGCTTGGAGAGTTGCTAGG + Intergenic
1176122016 20:63458248-63458270 CAGAAGCATGTGGAGAAGCTGGG + Intronic
1177385881 21:20408899-20408921 CATCTGCATGGGAAGAATCTTGG + Intergenic
1178209979 21:30519028-30519050 GAGCTGAAGGTGGAGCAGCTAGG + Intergenic
1180465305 22:15604874-15604896 AAGCTGCATGAGGAGTGGCTGGG + Intergenic
1181028796 22:20140266-20140288 GGGCTGCATGGGGACAGGGTGGG + Intronic
1181563932 22:23722491-23722513 GAGCTGCATCAGGAAAAGGTAGG + Intergenic
1181912604 22:26251899-26251921 GAGATGCATGGGGAGGAGCAGGG - Intronic
1183098508 22:35569023-35569045 GAGCTGCATGCGGGGAAGGTGGG + Intergenic
1183254950 22:36756314-36756336 GCGTTCCATGGGGAGAGGCTTGG - Intergenic
1183432386 22:37773629-37773651 GAGCTGCTTGGGAAGGAGCCAGG + Intronic
1183654566 22:39177185-39177207 GAGCAGTCTGGGGAGAAGCTGGG + Intergenic
1184171342 22:42761558-42761580 GAGCAGCTGGGGGAGCAGCTGGG - Intergenic
1184220079 22:43094454-43094476 GGGCAGCATGGGGAGGAGCATGG - Intergenic
1184682168 22:46078384-46078406 GAGCTGCAGGCGGTGAGGCTGGG - Intronic
1184696162 22:46140188-46140210 GGGCTGCCTGGGGAGCAGCGGGG + Intergenic
1184864707 22:47195691-47195713 GAGCTTGGTGGGGAGACGCTTGG + Intergenic
1184915117 22:47563808-47563830 GAGCTGCTTGGGGAGGTGTTGGG + Intergenic
1185116038 22:48938872-48938894 GGGCTGCATGGGAAGGAGGTTGG - Intergenic
1185333964 22:50263342-50263364 AAGCTGGCTGGGGAGAAGTTGGG - Intergenic
949515594 3:4804269-4804291 GAGCTGGAGGAGGAGAAGGTGGG + Intronic
950122667 3:10492215-10492237 GCTCTGCTGGGGGAGAAGCTGGG + Intronic
950184738 3:10938101-10938123 GAGCTGTAAGGGGCCAAGCTGGG + Intronic
953040735 3:39252922-39252944 AGGATGCATGGTGAGAAGCTGGG + Intergenic
953480478 3:43247330-43247352 GAGTTATATGGGGAGAAGTTAGG + Intergenic
953644460 3:44741465-44741487 CAGCTGCAGGGGTATAAGCTTGG - Intronic
954440813 3:50521062-50521084 GAGTTGCAATGGGAGAGGCTGGG + Intergenic
954446437 3:50549397-50549419 GAGCTCTGTGGGGAGGAGCTGGG + Intergenic
954608962 3:51934235-51934257 GAGCAGCATGGGGAGAGGCATGG - Intronic
954989469 3:54827897-54827919 GAACTCCAAGGGCAGAAGCTGGG - Intronic
956045281 3:65189599-65189621 GAACTGAATTGGGAGAGGCTTGG - Intergenic
957041744 3:75341180-75341202 AACCTGGATGGGGAGAAGCTGGG + Intergenic
960702376 3:120451050-120451072 GAGGAGAATGGGGAGGAGCTGGG - Exonic
961046458 3:123711973-123711995 AACCTGGATGGGGAGAGGCTGGG + Intronic
961811236 3:129523103-129523125 GATCTGCAGGGGGAGAATCAGGG - Intergenic
962376528 3:134863001-134863023 GGGCTTCCTGGAGAGAAGCTGGG + Intronic
962607508 3:137044886-137044908 GAGCTGCTTGGTGAGACTCTGGG + Intergenic
963101192 3:141606059-141606081 GAGTTGCATGTGGAACAGCTGGG - Intronic
966252679 3:177884280-177884302 GACCTGAATGGTGAGAAGGTAGG - Intergenic
967816859 3:193806679-193806701 GAGCTTCATGTGGAGAAGGTTGG + Intergenic
967834473 3:193949351-193949373 AAGAAGCATGGGGAGCAGCTTGG + Intergenic
967922792 3:194625262-194625284 GAGCAGCATGGGCAAAGGCTAGG - Intronic
968926624 4:3551760-3551782 GTCCTGCATGGTGAGAAGCTGGG - Intergenic
969209850 4:5678422-5678444 AAGTTGCATGAGGAGAAGTTTGG - Intronic
969613588 4:8240080-8240102 GAGGTGCCTGGGGAGAAGCTGGG + Intronic
970132719 4:12888885-12888907 GTGCCACATGGGCAGAAGCTTGG - Intergenic
970754440 4:19408077-19408099 AAGCTGCATTTGGAGAAACTAGG + Intergenic
971970153 4:33609085-33609107 CAGCAGCTTGGGGAGAAGTTGGG - Intergenic
972101051 4:35417437-35417459 GTACTGAATGGGCAGAAGCTAGG + Intergenic
972933669 4:44105009-44105031 GAGCTGCATAGAGAGATGATAGG - Intergenic
978201034 4:106023812-106023834 GAGCTGCTTGGAAGGAAGCTGGG - Intergenic
979570291 4:122215478-122215500 CAGCTGTTTGGGGAGAAGGTGGG + Intronic
981090021 4:140722572-140722594 GGGATGAGTGGGGAGAAGCTAGG + Intronic
984166854 4:176313053-176313075 AAGGTGCATGAGGAGAAGTTTGG + Intergenic
984936970 4:184898045-184898067 AAGCTCCATGGGGAGAAACGGGG + Intergenic
985508505 5:298782-298804 GAGCAGCTGGGGGAGCAGCTGGG - Intronic
985508529 5:298849-298871 GAGCAGCTGGGGGAGCAGCTGGG - Intronic
985995128 5:3593495-3593517 GAGCTGGGTGGGGAGGAGCTGGG - Intergenic
990635567 5:57722420-57722442 GAGCAGCATAGGAAGTAGCTGGG + Intergenic
990895663 5:60698251-60698273 GAGGTGCATGTGGAGAGGATGGG - Intronic
991091963 5:62702260-62702282 GAGCAGCTGGGGGAGAAGCTTGG - Intergenic
996478266 5:123945850-123945872 GAGCTGTTTGGGGTGAAGGTGGG - Intergenic
998205532 5:140154502-140154524 TGGCTGCCTGGGAAGAAGCTGGG - Intergenic
999475191 5:151891791-151891813 GAGCTGTTTGGGGAGGAGCAGGG + Intronic
1000969337 5:167696790-167696812 GAGGTGCAAGAGGAGCAGCTGGG - Intronic
1002375904 5:178788994-178789016 GTGTTGCAGGGGCAGAAGCTGGG - Intergenic
1002925912 6:1605477-1605499 GACCTGGATGGAGAGAAACTGGG + Intergenic
1003013863 6:2452104-2452126 AAGCTGAGTGGGGAGAAGCCAGG - Intergenic
1003146534 6:3514808-3514830 GAGCAGGCTGGGGAGAGGCTGGG + Intergenic
1003816979 6:9851952-9851974 GAGCTGGAGGGGGCAAAGCTAGG - Intronic
1004839782 6:19569716-19569738 CAGCTGCAAGGGGAACAGCTGGG + Intergenic
1006338115 6:33431585-33431607 GAGTAGCAGGGGGAGAAGCTGGG - Intronic
1006881578 6:37344502-37344524 GAGCTGACTGTGGAGAGGCTTGG - Intergenic
1007229970 6:40341405-40341427 GAGCTGCATGCCAAGAAACTAGG - Intergenic
1007816005 6:44526051-44526073 GAGCTTCATGGAGAGTGGCTGGG - Intergenic
1013085065 6:106849784-106849806 GAGCTGCATGTGGGGAAAGTGGG + Intergenic
1013756761 6:113471241-113471263 GTTGTGCATGGGGAGAAGGTAGG - Intergenic
1014160953 6:118167926-118167948 GAGCTGGATGGAGAGAAGAGTGG - Intronic
1014253520 6:119139110-119139132 GAGCTACATGGGGAGAGGAGTGG - Intronic
1015041287 6:128723016-128723038 CAGCCACATGGGGAAAAGCTGGG - Intergenic
1015168973 6:130229815-130229837 GAACCGCATAGGGAGGAGCTAGG + Intronic
1015678717 6:135780804-135780826 GGGCTGAAGGGGAAGAAGCTGGG + Intergenic
1017086600 6:150718349-150718371 GAGCTAAATGGGGAGAAACCAGG + Intronic
1017981118 6:159401879-159401901 GAGCTGCATGGGGACTGGCAAGG - Intergenic
1019030282 6:169004214-169004236 GAGCAGCATGGGGAGAACTTGGG - Intergenic
1020131232 7:5559707-5559729 GGGCTGCTTGGGGATAGGCTTGG - Intronic
1022201148 7:28119107-28119129 GGGCTGCCTGGGGAGCAGCATGG - Intronic
1023016358 7:35971654-35971676 GAGCAGCATGGAGAGGAGCCGGG - Intergenic
1025267335 7:57474520-57474542 CAGCTGGATGTGGAGCAGCTGGG - Intergenic
1026975941 7:74498467-74498489 GAGAAGCAAGGGAAGAAGCTTGG - Intronic
1027311605 7:76957867-76957889 GAGGAGTATGGGGAGAAGCCGGG - Intergenic
1027480659 7:78692544-78692566 GAGCTGCAAAGGGAGAAGTCAGG + Intronic
1027629373 7:80583581-80583603 GAACTGTGTGGGAAGAAGCTGGG - Intronic
1031940244 7:127781130-127781152 GAGCTGCTTCAGGAGAAGGTAGG + Intronic
1033406072 7:141072831-141072853 GAGATGAATGGGGAGAGGGTGGG - Intergenic
1033995710 7:147344242-147344264 GAGCTGCGTGGGTAGAATTTTGG - Intronic
1034395372 7:150820339-150820361 TGGCTGCAGGGAGAGAAGCTGGG + Intergenic
1034492940 7:151403944-151403966 GAGATGCGTCGGGAGCAGCTGGG - Intronic
1034958293 7:155349638-155349660 ACGCTGCATGGGGAGCAGCTGGG - Intergenic
1035704033 8:1661222-1661244 CAGCGGGATGAGGAGAAGCTGGG - Intronic
1036007796 8:4686834-4686856 GAGCTGCAGGGAGAGAAGGAAGG + Intronic
1036750929 8:11443438-11443460 GTCCTGCCTGGGGAGAAGCTCGG - Intronic
1037308312 8:17528874-17528896 GAGCTGCATAAGGAGAAGACAGG + Intronic
1038020779 8:23550527-23550549 GAACTGCATTTGTAGAAGCTGGG + Intronic
1038062771 8:23930794-23930816 GAGCTGCCTTGAGAGATGCTGGG + Intergenic
1039929312 8:41969762-41969784 GAGTTGCATAAGGTGAAGCTGGG - Intronic
1041848568 8:62360085-62360107 TGGCTGCATGGGGTGAAGCCTGG - Intronic
1043395284 8:79829407-79829429 CAACAGCATGTGGAGAAGCTTGG + Intergenic
1043756188 8:84006109-84006131 CAGCTGCAGCGGGAGAGGCTCGG - Intergenic
1048109564 8:131453463-131453485 GAGCTGCTTGGAGAGATGGTAGG + Intergenic
1048797460 8:138164289-138164311 GAGGTCCATGGAGAGAAGCCTGG + Intronic
1048809273 8:138270414-138270436 GGGCTTCATGGGTAGAAGGTTGG + Intronic
1048879638 8:138861686-138861708 CAGAGGCAAGGGGAGAAGCTGGG - Intronic
1049047231 8:140162342-140162364 AAGCAGCATGTGGAGAAGCAGGG - Intronic
1049066610 8:140321330-140321352 GAGCTGAATGGGAACAAGCGAGG - Intronic
1049416444 8:142497678-142497700 CTGCTGCAGGGGCAGAAGCTAGG - Intronic
1049422865 8:142524601-142524623 GAGTGGCATGGGAGGAAGCTGGG + Intronic
1049441520 8:142611908-142611930 GGGCTCCATGGGGAGGGGCTGGG + Intronic
1049457624 8:142701433-142701455 GAGCCGCATGGGGAGAAAGCAGG - Intronic
1049541054 8:143209175-143209197 GAGCAGCATGGAGGGGAGCTGGG + Intergenic
1050763691 9:9106218-9106240 GAGATGCATGGGGAGAATAGGGG - Intronic
1051368959 9:16342004-16342026 GACCTGCCAGGGAAGAAGCTGGG - Intergenic
1051689832 9:19699208-19699230 GAACTGCATGGGGACAAGAACGG + Intronic
1052975273 9:34405596-34405618 TAGCTGCAGGGGGAAAAGCATGG - Intronic
1053406356 9:37879812-37879834 CACCTGCATGGGCAGAGGCTGGG + Intronic
1053452343 9:38203513-38203535 GTGCTTGATGGGGAGATGCTTGG + Intergenic
1053789148 9:41674186-41674208 TAGCTGGAGGGGGAGAATCTTGG - Intergenic
1053801543 9:41767142-41767164 GTCCTGCATGGTGAGAAGCTGGG - Intergenic
1054143656 9:61547684-61547706 GTCCTGCATGGTGAGAAGCTGGG + Intergenic
1054155991 9:61640575-61640597 TAGCTGGAGGGGGAGAATCTTGG + Intergenic
1054189974 9:61979296-61979318 GTCCTGCATGGTGAGAAGCTGGG - Intergenic
1054463432 9:65479019-65479041 GTCCTGCATGGTGAGAAGCTGGG + Intergenic
1054475761 9:65571577-65571599 TAGCTGGAGGGGGAGAATCTTGG + Intergenic
1054648540 9:67609295-67609317 GTCCTGCATGGTGAGAATCTGGG + Intergenic
1054660102 9:67695269-67695291 TAGCTGGAGGGGGAGAATCTTGG + Intergenic
1055113791 9:72585974-72585996 GAGCTGCTTGAGAAGAACCTGGG + Intronic
1055570767 9:77614813-77614835 GCTCTTCATGGGGAGAATCTAGG - Intronic
1060572936 9:124659566-124659588 GAGTTGGTGGGGGAGAAGCTTGG - Intronic
1060607891 9:124933916-124933938 AAGGTGCATGGGGAAAAGCTTGG - Intronic
1061491610 9:130947949-130947971 AAGCTGCATAGAGAGAACCTCGG + Intergenic
1061548012 9:131315869-131315891 GAGCTGGATGGGGACAAACCCGG - Intergenic
1061969486 9:134036190-134036212 CGGCTGCCCGGGGAGAAGCTGGG - Exonic
1203745415 Un_GL000218v1:38424-38446 GAGGTGCAGGGGGAGGAGTTGGG + Intergenic
1203564693 Un_KI270744v1:81060-81082 GAGGTGCAGGGGGAGGAGTTGGG - Intergenic
1185999321 X:4990050-4990072 GGGCTGCCTCGTGAGAAGCTGGG - Intergenic
1186613279 X:11159583-11159605 AAGCTGCAGGAGGAGAAGGTTGG + Intronic
1186768997 X:12799005-12799027 AAGGTGCATGGGGTGAAGTTGGG - Intronic
1189058705 X:37728616-37728638 GAACTGTATGGGAAGAAGCCAGG + Exonic
1190732033 X:53232950-53232972 GGGCTGTATGGAGAGGAGCTGGG - Exonic
1192197015 X:69035154-69035176 GAGCAGGATGGGTAGAGGCTGGG - Intergenic
1192610059 X:72559024-72559046 GAGGGGGAGGGGGAGAAGCTAGG - Intronic
1195925592 X:110021560-110021582 GAGCTGCAGAGGGAGAAGGAAGG + Intronic
1197087983 X:122501804-122501826 CAGCTGCCTGGAGAGAAGGTGGG + Intergenic
1197446071 X:126552999-126553021 GAGCTGCAAGGGCAGAGTCTAGG + Intergenic
1198517070 X:137420356-137420378 GAATTGAATGGGGAGAACCTGGG + Intergenic
1198693055 X:139305099-139305121 AAGCTGCATGAGGAGTAACTGGG + Intergenic
1199541384 X:148961165-148961187 GAGCTGCCTGAGGAGAAACTGGG - Intronic
1199600592 X:149539404-149539426 GAGCTGCCGGAGGAGGAGCTGGG - Intergenic
1199649963 X:149940441-149940463 GAGCTGCGGGAGGAGGAGCTGGG + Intergenic
1199649993 X:149940549-149940571 GAGCTGCAAGAGGAGAAGTTGGG + Intergenic
1199783970 X:151087593-151087615 GAGATGCAAGGGCAGAAGCAAGG - Intergenic
1201158735 Y:11153435-11153457 GAGGTGCAGGGGGAGGAGTTGGG + Intergenic
1201555259 Y:15260165-15260187 GAGAAGCATGGGCAGAAACTGGG + Intergenic
1201556295 Y:15267300-15267322 GAGAAGCATGGGCAGAAACTGGG + Intergenic
1202380268 Y:24270819-24270841 GACCTGCCTGGGGAGCAGGTAGG + Intergenic
1202490515 Y:25399306-25399328 GACCTGCCTGGGGAGCAGGTAGG - Intergenic