ID: 1150221223

View in Genome Browser
Species Human (GRCh38)
Location 17:63496935-63496957
Sequence TGCATGGGGAGAAGCTGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221217_1150221223 -6 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221223 17:63496935-63496957 TGCATGGGGAGAAGCTGGGCTGG 0: 1
1: 0
2: 5
3: 36
4: 437
1150221215_1150221223 11 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221223 17:63496935-63496957 TGCATGGGGAGAAGCTGGGCTGG 0: 1
1: 0
2: 5
3: 36
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221223 Original CRISPR TGCATGGGGAGAAGCTGGGC TGG Exonic
900506686 1:3032813-3032835 TGAAGGGGCAGCAGCTGGGCAGG + Intergenic
901479941 1:9518344-9518366 TGAATGAGGAGCAGCTGGGAAGG - Intergenic
901635343 1:10667851-10667873 GAGATGGGGAGAAGGTGGGCTGG - Intronic
901868463 1:12123447-12123469 TGCCTGGGAGGCAGCTGGGCTGG + Intronic
902548237 1:17203857-17203879 TGCAGGAGGGCAAGCTGGGCAGG - Intergenic
902598499 1:17525222-17525244 TGCGGAGGGAGAAGGTGGGCAGG - Intergenic
902648706 1:17822726-17822748 TGCAGTGGGAGAAGCTGAGTGGG + Intronic
902933142 1:19745341-19745363 TGGATGGCGAGATGATGGGCAGG + Intronic
903500892 1:23799738-23799760 GGCATGGGCAGAGGCTGAGCGGG - Intronic
903577605 1:24348400-24348422 AGCATGAGGAGAGCCTGGGCTGG - Intronic
904697216 1:32337212-32337234 GGCAGGGTGGGAAGCTGGGCTGG - Intergenic
905174615 1:36127636-36127658 TGCATGGGGACGGGCTGGGAGGG + Intergenic
905929930 1:41779843-41779865 TGCATGGGGAGAAAGTGGAAAGG + Intronic
906202898 1:43971435-43971457 TGGTTGGGGAAAAGCTGGGCTGG - Exonic
906328187 1:44861948-44861970 TGGATGGGGAAAAGCTGTGTTGG - Intronic
907917114 1:58881522-58881544 TTCATGGGGTGAAGATGGGGCGG - Intergenic
908327373 1:63036375-63036397 TGCATGGGGAAGAACTGGACTGG - Intergenic
908673643 1:66576887-66576909 TGCTTGGGGAGAAGGTGGGAGGG - Intronic
910382768 1:86646365-86646387 AGCATTGGCAGAAACTGGGCGGG - Intergenic
911641787 1:100297666-100297688 AGCATGGGGGGAAGGTGGGCGGG - Intergenic
911768243 1:101705586-101705608 TTCTTATGGAGAAGCTGGGCTGG + Intergenic
912821144 1:112868769-112868791 AGGTTGGGGAGAAGCTGGGAAGG - Intergenic
915739478 1:158107684-158107706 AGAATGGAGAGAAGGTGGGCAGG - Intergenic
915994587 1:160550167-160550189 TGAATGGGTAGCAGTTGGGCAGG + Intronic
916213158 1:162374536-162374558 TGTAGGGGGAGAACCAGGGCCGG + Exonic
917143189 1:171858520-171858542 TGCTTTGGGAGATGCTGGGATGG - Intronic
919660216 1:200236799-200236821 TGGATGGTGAGAAGCTGGGGTGG - Intergenic
919774741 1:201187209-201187231 TCAATGAGGAGAAGCTGGGGAGG - Intergenic
920030803 1:203036396-203036418 TGCCTGGGGATCTGCTGGGCTGG + Intronic
920046111 1:203133668-203133690 TGGAGGGGAAGATGCTGGGCGGG - Intronic
920417071 1:205806006-205806028 TCCTGTGGGAGAAGCTGGGCTGG + Intronic
920760776 1:208781965-208781987 TGAATGGGGACAGGCAGGGCAGG - Intergenic
921883542 1:220280350-220280372 TGCATCAGGGGGAGCTGGGCTGG - Intergenic
922083183 1:222318212-222318234 TGCATGTGGAGAAGGAGGGCGGG - Intergenic
923712960 1:236401692-236401714 TGCATGTGGAAAGGATGGGCAGG + Intronic
923740046 1:236646696-236646718 TGCATGGTGAGCAGCCAGGCTGG + Intergenic
924554600 1:245107810-245107832 TGCTTGGAGGGAATCTGGGCTGG - Intronic
924709163 1:246519645-246519667 GGAATGGGGAGAAGAAGGGCAGG + Intergenic
1062831736 10:610312-610334 AGCATGGGGAGAGGCTGGTAAGG + Intronic
1063048467 10:2418448-2418470 GGCATGGGGAGTAGCAGGCCTGG - Intergenic
1063200103 10:3779674-3779696 TGCAGGGGGTTAGGCTGGGCAGG - Intronic
1065205773 10:23356512-23356534 TGCTTAGGGAGAAGCTGTGCTGG - Intergenic
1065306221 10:24371637-24371659 TGCATGGGGAAAACATGGGAAGG - Intronic
1067429927 10:46236281-46236303 TGGATGGGGACTAGCAGGGCAGG - Intergenic
1067443718 10:46327538-46327560 TGGATGGGGACTAGCAGGGCAGG + Intronic
1067563830 10:47322589-47322611 GGCACGGGGAGGAGCTGGGAAGG - Exonic
1069412142 10:68164569-68164591 TGCATTAGGAGAAACTTGGCAGG - Intronic
1069742773 10:70696068-70696090 GACATGGGCAGTAGCTGGGCAGG + Intronic
1070149886 10:73799181-73799203 GGCAGGTGGGGAAGCTGGGCGGG + Exonic
1070717953 10:78736166-78736188 TGCATAGGGAGAAAGTTGGCAGG - Intergenic
1071875097 10:89836712-89836734 TTCAAGAGGAGATGCTGGGCAGG + Intergenic
1072303187 10:94082156-94082178 TTCATGGAGAGAGGCTGGGAAGG - Intronic
1072447427 10:95511783-95511805 TGAATGGGGTGATGCTGGGCTGG - Intronic
1072549790 10:96468783-96468805 AGGATTTGGAGAAGCTGGGCTGG - Intronic
1072765833 10:98094488-98094510 AGAATGTGGAGAAGCTGGGAAGG + Intergenic
1073071592 10:100797942-100797964 TGAATAGGGAGAGGCTGGGGTGG - Intronic
1073140022 10:101241085-101241107 TGCACAGGCAGAACCTGGGCTGG - Intergenic
1075038973 10:119092555-119092577 AAGATAGGGAGAAGCTGGGCTGG + Intergenic
1075310975 10:121413082-121413104 TGAATGAGGAGAGGCTGGTCTGG - Intergenic
1075343451 10:121665093-121665115 TGCAAGGGCAGAGACTGGGCTGG - Intergenic
1075466021 10:122650755-122650777 TGCATGGGGTGGAGGTGGGTTGG - Intergenic
1075618037 10:123905669-123905691 TGAATAGGGAGAAGCTGCGTGGG - Intronic
1075657573 10:124172451-124172473 TGCAATCGGAGAAGCAGGGCCGG - Intergenic
1076439129 10:130467518-130467540 TTCAAGGGAAGCAGCTGGGCTGG + Intergenic
1076757095 10:132578371-132578393 TGCATGTGGAGCACCTCGGCCGG + Intronic
1076889779 10:133277747-133277769 TCCCTGGGGAGAGGCAGGGCAGG + Intergenic
1077147054 11:1051033-1051055 AGAAGGGAGAGAAGCTGGGCAGG - Intergenic
1078022595 11:7668233-7668255 GGCTTGGGGGCAAGCTGGGCAGG - Intronic
1078410202 11:11108402-11108424 CTAATGGGGAGAAGCAGGGCTGG + Intergenic
1078877028 11:15409250-15409272 GGCTTGGGGAGCAGCCGGGCTGG - Intergenic
1079130473 11:17744309-17744331 GCCCTGGGGAGGAGCTGGGCTGG - Intronic
1079195330 11:18322045-18322067 TGGATGTGGTGGAGCTGGGCTGG - Exonic
1079355982 11:19730603-19730625 TTAATGGGGAGCAGCTGGGGTGG + Intronic
1080617517 11:33957605-33957627 TGTATGAGGAGAAGCTGGTTTGG - Intergenic
1080728825 11:34925695-34925717 TGTATGTGTACAAGCTGGGCAGG + Intronic
1081442134 11:43092465-43092487 GGCATGGTGAGGAGCTGGGCTGG - Intergenic
1083140681 11:60718713-60718735 TGCATGATGGGAAGCAGGGCAGG - Intergenic
1083233449 11:61337550-61337572 TGCTGGGGGAGGAGCTGAGCAGG - Intronic
1083659188 11:64244407-64244429 CACCTGGGGAGAAGCTGAGCTGG + Intergenic
1083938497 11:65882721-65882743 TGCAGGGGGACAGGGTGGGCAGG + Intronic
1084093435 11:66894373-66894395 TGCATGGGCAAAAGCTGGGACGG - Intronic
1084093928 11:66897712-66897734 GGCCTGGGGAGAAGCAGGCCAGG - Intronic
1084383702 11:68829124-68829146 TGCCTGGGAAGAAGCAGGGATGG + Intronic
1084474639 11:69381758-69381780 TCCATGGGGAGGGGCGGGGCAGG + Intergenic
1084717050 11:70880658-70880680 GGGATGGGGAGACCCTGGGCTGG + Intronic
1084776339 11:71379283-71379305 TGCATGGATACAGGCTGGGCTGG + Intergenic
1084933393 11:72574355-72574377 TGCAAGGGGAGAGGGTGGGCAGG - Intergenic
1085262431 11:75214763-75214785 TGCCTGGGTGGGAGCTGGGCAGG - Intergenic
1086262184 11:84953413-84953435 TGGATGGGAAGTAGCTGGCCAGG - Intronic
1089043738 11:115480724-115480746 TGCAGGGTGAGAAACTGGGAAGG - Intronic
1089385140 11:118062425-118062447 GGCCTGGAGAGGAGCTGGGCTGG - Intergenic
1089596901 11:119586276-119586298 TGTATGTGAAGAAGCTGGGAAGG - Intergenic
1089626301 11:119753148-119753170 TGGGTGGGGACAAGCAGGGCTGG + Intergenic
1089792137 11:120953024-120953046 TGCATGGGGAGGGGGTGGGGAGG + Intronic
1090363017 11:126186443-126186465 AGCCTGGGGAGAAGCAGGCCTGG + Intergenic
1090974654 11:131671090-131671112 TGCTTGGAGAGAAACAGGGCTGG - Intronic
1091223020 11:133941726-133941748 TTCATAGGGAAATGCTGGGCGGG - Intronic
1091315161 11:134609528-134609550 CGCATGTGGAGATGCTGTGCGGG + Intergenic
1092173422 12:6387545-6387567 GGCCTGGGGAGAAACTGGACTGG - Intronic
1093640809 12:21525292-21525314 AGTAATGGGAGAAGCTGGGCAGG - Intergenic
1096262829 12:50103750-50103772 ACCATGGTGGGAAGCTGGGCTGG + Intergenic
1097419268 12:59353814-59353836 AGTTTGGGGAGAAGCTGGGAAGG + Intergenic
1100303028 12:93325368-93325390 TGAATGGGAATAGGCTGGGCAGG - Intergenic
1100562038 12:95756819-95756841 AGCATGGGCAACAGCTGGGCAGG - Intronic
1101590000 12:106117069-106117091 TGAATAGGGAGGGGCTGGGCAGG - Intronic
1102076579 12:110064836-110064858 TGCAGGGTGGGAGGCTGGGCTGG + Intronic
1102813425 12:115843378-115843400 TGGATTGGGAAAAGATGGGCAGG + Intergenic
1102866962 12:116382241-116382263 TGAAAGGGGTGAAACTGGGCGGG - Intergenic
1103732578 12:123037655-123037677 TGCATGGGGATGAGCAGGGCAGG - Intronic
1103884645 12:124191403-124191425 TCCATGGGGAGAGGCCAGGCAGG - Intronic
1103905721 12:124326372-124326394 TGCAGGGGGACAAGATGGGAAGG + Intronic
1103995523 12:124827554-124827576 AGGCTGGGGAGAAGCTGGGAAGG + Intronic
1104460478 12:128951977-128951999 TGCACGGGGAGACGCAGGGGAGG - Intronic
1104758211 12:131281922-131281944 TGCATGAGGGGAGGCTGGACAGG + Intergenic
1104828781 12:131733848-131733870 TGCATGGGGAGTGGAGGGGCAGG - Intronic
1104896948 12:132169197-132169219 GGCAGGGGGAGAAGCAGGGAGGG + Intergenic
1104896974 12:132169265-132169287 GGCAGGGGGAGAAGCAGGGAGGG + Intergenic
1105356619 13:19664945-19664967 TGCGTGGGGAGAAGCAGAGGAGG + Intronic
1105398456 13:20064329-20064351 TACATGGGGACAATCTAGGCTGG - Intronic
1110280034 13:73682204-73682226 TGCCTTGGGAGCAGGTGGGCAGG + Intergenic
1110794702 13:79622853-79622875 TGCAGGGGCAGGGGCTGGGCAGG + Intergenic
1111892067 13:94095742-94095764 TGGAGGGGGAGAAATTGGGCAGG + Intronic
1112336704 13:98522555-98522577 TGCTTGGGAAGCAGCTGGTCTGG - Intronic
1112976396 13:105324051-105324073 TCCATGGAGAGAAGCTAGGAAGG - Intergenic
1113117061 13:106885220-106885242 TGGGGAGGGAGAAGCTGGGCAGG + Intergenic
1113707850 13:112445767-112445789 TTCACAGTGAGAAGCTGGGCTGG + Intergenic
1114211262 14:20617118-20617140 GGCATGGGGACACGGTGGGCAGG + Intergenic
1114446934 14:22795863-22795885 TGCCTCAGAAGAAGCTGGGCAGG - Intronic
1114662172 14:24354071-24354093 TTCCTGGGGAGAAGCAGGGATGG + Intergenic
1115310685 14:31975096-31975118 GTCATGGGCAGCAGCTGGGCAGG + Intergenic
1118276241 14:64388275-64388297 TGCAGGGGGAGAAGCGGGCAGGG + Intronic
1119601769 14:75981453-75981475 TAGGTGGGGAGAAGCAGGGCCGG + Intronic
1120211814 14:81641170-81641192 AGGTTGGGGAGAAGCTGGGAAGG + Intergenic
1120963651 14:90148541-90148563 TGAATGGGAAGAAGAGGGGCAGG + Intronic
1122075066 14:99230601-99230623 CACTTGGGGAGAAGCAGGGCAGG + Intronic
1122246302 14:100405650-100405672 TGCAAGGGCAGAAGCAGAGCTGG + Intronic
1122408053 14:101512097-101512119 GGCATGGGGTGGACCTGGGCCGG - Intergenic
1122640419 14:103156172-103156194 TGCATGGGGTGAAGCTAGGCAGG - Intergenic
1122642147 14:103166202-103166224 TGGATCGGGAGGAGCAGGGCTGG - Intergenic
1122717655 14:103705283-103705305 TGGCTGGAGAGAGGCTGGGCTGG + Intronic
1122897796 14:104769024-104769046 TGGCTGGGGTGAAGCTGGGTGGG + Intergenic
1123439656 15:20281275-20281297 TGCCTGGGGAGGAGCGGGGCTGG + Intergenic
1123761851 15:23439695-23439717 TGCAGGAGGAGAGGCTGGGGAGG - Exonic
1124854895 15:33378226-33378248 AGAATGGGAAGAAGGTGGGCTGG - Intronic
1126384112 15:48076220-48076242 TCCATGGGGATTAGGTGGGCTGG - Intergenic
1126800061 15:52289957-52289979 TGGATGGGGAGAGGATGGGTGGG - Intronic
1128451809 15:67810211-67810233 TGGATGGGGTGAGGGTGGGCGGG - Intergenic
1128736892 15:70058557-70058579 TGGAGTGGGAGAAGCTGGGTGGG - Intronic
1128951819 15:71892870-71892892 TACATGGGAAGAAGCTGTGAAGG + Intronic
1129267404 15:74401428-74401450 TGCATGGGAAGAGGGTAGGCAGG - Intergenic
1129702564 15:77776133-77776155 GGCAGGGGGAGGAGCTGGGAGGG - Intronic
1129891234 15:79073316-79073338 TTCCTGTGGGGAAGCTGGGCTGG + Intronic
1131269042 15:90935427-90935449 TGGATGGGGAGAAGGAGGCCAGG - Intronic
1132237765 15:100234816-100234838 CGCCTTGGGAGAAGCTGGGATGG - Intronic
1132435807 15:101801334-101801356 TGCATGGGCAGCAACTGAGCAGG - Intergenic
1132496386 16:265377-265399 GGCCTGGGGAGAAGCTGGCAAGG - Exonic
1132614349 16:832795-832817 TGGATGGGGCGGAGCGGGGCGGG - Intergenic
1132670587 16:1100777-1100799 TGCAGGGGGAGGAGGTGGGGAGG + Intergenic
1132769548 16:1553655-1553677 TGGGTGGGCAGAAGCGGGGCTGG + Intronic
1133141314 16:3746697-3746719 AGCATGTGGAGAGGCTGGGGTGG + Intronic
1133170592 16:3980487-3980509 TGCCTCAGGAGAGGCTGGGCGGG + Intronic
1135631594 16:24039760-24039782 AGCATGGAGGGGAGCTGGGCAGG + Intronic
1136140361 16:28284329-28284351 TGCCTGTGGAGGAGCTGGGATGG + Intergenic
1136455678 16:30378507-30378529 TGCATGCGGCGCAGCTGTGCAGG + Exonic
1136845511 16:33573122-33573144 TGCCTGGGGAGGAGTGGGGCTGG - Intergenic
1137056169 16:35747612-35747634 TGCCTGGGGACAACCGGGGCTGG + Intergenic
1137620241 16:49871563-49871585 TGTATGGGAAGGGGCTGGGCTGG + Intergenic
1138331394 16:56218635-56218657 GGCAAGGGAAGAAGCTGGGTGGG - Intronic
1138496991 16:57415057-57415079 TGCAGGGAGAGGAGCGGGGCAGG - Intronic
1139168037 16:64594325-64594347 TGGATGGGGAGAAGTTGGGGAGG - Intergenic
1139304046 16:65968371-65968393 TAGATGGGCAGAACCTGGGCAGG - Intergenic
1139884272 16:70197565-70197587 TGCCTTGGCAGAGGCTGGGCTGG - Intergenic
1140368244 16:74397931-74397953 TGCCTTGGCAGAGGCTGGGCTGG + Intergenic
1141883047 16:86872557-86872579 TGCATGGGAAGAAATTGGCCAGG + Intergenic
1142415282 16:89937784-89937806 GGGATGTGGAGAAGCAGGGCTGG - Intergenic
1203107219 16_KI270728v1_random:1421775-1421797 TGCCTGGGGAGGAGTGGGGCTGG - Intergenic
1143289699 17:5819690-5819712 TGGCTGGAGAGAAGCTGGCCAGG + Intronic
1143340035 17:6203638-6203660 TGCAAGGAGAGATGCTGGGAGGG - Intergenic
1143352162 17:6296971-6296993 GGCAGAGGGAGAAGCTGAGCTGG - Intergenic
1143500257 17:7334797-7334819 AGGATGGTGAGAACCTGGGCAGG + Intergenic
1143586917 17:7854990-7855012 GGGGTGGGGAGAGGCTGGGCCGG + Intergenic
1143865071 17:9917534-9917556 TGCAGGGTGAGAAGCAGGGTCGG - Intronic
1144827206 17:18112193-18112215 TTGCTGGGGAGAAGCAGGGCAGG - Intronic
1145988299 17:29062255-29062277 TGCTTGGGGGCAGGCTGGGCAGG - Intergenic
1147446184 17:40476571-40476593 GGAATGGAAAGAAGCTGGGCTGG + Exonic
1147609396 17:41792810-41792832 AGCATGGCCAGAAGCTGGGAAGG + Intergenic
1147886757 17:43689506-43689528 TCCAAGGGGAGATGGTGGGCTGG + Intergenic
1148106636 17:45122210-45122232 TGCCTGGAGATCAGCTGGGCAGG - Intronic
1149498251 17:57132566-57132588 TGCAGGGGGTGAGGGTGGGCCGG + Intergenic
1150221223 17:63496935-63496957 TGCATGGGGAGAAGCTGGGCTGG + Exonic
1151481329 17:74371617-74371639 TGCATGTGCAGAGGCTGCGCTGG - Intronic
1151582035 17:74985491-74985513 TGGTGGGGGAGAAGCTGGGTTGG - Intergenic
1151680458 17:75620165-75620187 AGCAGGGGGAGCAGGTGGGCAGG + Intergenic
1151757188 17:76081721-76081743 TGCAGGAGGAGGAGCTGGGCAGG - Exonic
1152241859 17:79165097-79165119 GGCATGGGGAGCAGCCGGGAGGG + Intronic
1152314616 17:79572869-79572891 TGCATGGGGTGAGGGTGGGTGGG - Intergenic
1153486636 18:5605196-5605218 GGCAGAGGGAGAAGTTGGGCTGG - Intronic
1153633329 18:7092950-7092972 CGCATGGGGAAAACCTGGGAAGG + Intronic
1155352177 18:24917621-24917643 TGCATGGGAGGAGGCAGGGCAGG + Intergenic
1157189095 18:45565739-45565761 TGCCTGTGGAGAAGCGGGTCAGG - Intronic
1157493465 18:48139432-48139454 CGCCTGGGGGTAAGCTGGGCTGG - Intronic
1157517554 18:48321569-48321591 GGGATGGGGAGGAGCTGGGGAGG - Intronic
1157757065 18:50228252-50228274 TGAAAGGGGAAAAGCTGGCCAGG - Intronic
1158235533 18:55308920-55308942 TCCATGGGGAGGTGCTGGCCTGG - Intronic
1158391905 18:57051224-57051246 TACACTGGGAGAAGCTGGGTTGG + Intergenic
1159648150 18:70943736-70943758 AGCATGTGGTGAAGCTGGCCAGG - Intergenic
1160211133 18:76880865-76880887 TTCATGGGGAAGAGCTGGCCAGG + Intronic
1160904359 19:1445507-1445529 GGCATGGGGAGCTGCTGGGGAGG - Intergenic
1161818766 19:6516435-6516457 GGCCTGGGGAGAAGCTAGGGAGG + Intergenic
1161938738 19:7388966-7388988 AACATGAGGAGAAGCTGGGAAGG - Intronic
1162131811 19:8530560-8530582 TCCAGGAGGAAAAGCTGGGCGGG + Exonic
1162721459 19:12665295-12665317 TGCAGAAGCAGAAGCTGGGCTGG + Intronic
1162918283 19:13885729-13885751 TGGGTGGGGAGATGCTGGGTTGG + Intronic
1163271828 19:16259062-16259084 TGCATTGGGAGAAAGTGGGTTGG - Intergenic
1163402200 19:17100969-17100991 TGCTTGGGGAGCTGCTGGGGAGG + Intronic
1164011846 19:21210503-21210525 GGAATGAGGAGCAGCTGGGCTGG - Intergenic
1166759886 19:45217912-45217934 GGAATGGGGAGAGGCTGGGATGG - Intronic
1166840204 19:45692633-45692655 TCCATGGGGAGGAACTTGGCTGG + Exonic
1166887831 19:45972765-45972787 TGCGTGGGGACAGGCTGGGTAGG - Intronic
1166930052 19:46296989-46297011 GGCGTGGGGAGGAGCTGGGGAGG + Intergenic
1166980909 19:46631582-46631604 AGCGGGGAGAGAAGCTGGGCAGG - Intergenic
1167960716 19:53102775-53102797 TCCAGGGGGTGGAGCTGGGCAGG + Intronic
1167994117 19:53388763-53388785 AGGTTGGGGAGAAGCTGGGAAGG + Intronic
1168524023 19:57074534-57074556 TGCAGGGGGAGAGAGTGGGCGGG - Intergenic
1168642071 19:58037465-58037487 TGCGAGGGGAGGAGCTGGGGTGG + Intronic
925163394 2:1702268-1702290 GGCAGGGGGAGAGGATGGGCAGG - Intronic
925189548 2:1871653-1871675 AGCCTGGGGAGCAGCTGGGCCGG - Intronic
925317989 2:2939946-2939968 TGCATGGGGACAACCTACGCAGG + Intergenic
925363394 2:3295112-3295134 TGCATGGAGAGAGGATGGGCTGG - Intronic
925404791 2:3599023-3599045 TGCATGGGGAGAGGGTAGTCGGG + Intronic
925411399 2:3641900-3641922 TGGATGGTGAGGTGCTGGGCAGG + Intronic
927149598 2:20188032-20188054 TGCCTGGGGAGAATTTGGGTGGG + Intergenic
927962969 2:27251964-27251986 AGCATGGCGAGCAGCTGGGGCGG + Intergenic
929244483 2:39686672-39686694 AGGATGGGGAGAAGATGGGGGGG + Intronic
929445553 2:41998198-41998220 TCCCTGGGGAGAAGCTGGCAGGG + Intergenic
929670213 2:43871542-43871564 TCCATGGGGAGAAGTTGGGCTGG - Intronic
931411557 2:62037354-62037376 AGAATGGGAAGGAGCTGGGCAGG - Intronic
932482789 2:72057629-72057651 TGAATGGGCAAAAGCTGGGAGGG - Intergenic
932881181 2:75503559-75503581 TGCATGGAGACCAGCTGGCCTGG - Intronic
933899889 2:86841895-86841917 TTCATGGGGTGATGCTGGGCTGG - Intronic
935144748 2:100387963-100387985 GGCAGGGGGAGCAGCAGGGCAGG + Intergenic
935193853 2:100799482-100799504 GGCATGGCGAGAAGCTGTGGAGG - Intergenic
935579770 2:104746450-104746472 TGCATGGATAGCAGCTGGGAGGG + Intergenic
935780670 2:106507330-106507352 TTCATGGGGTGATGCTGGGCTGG + Intergenic
936147277 2:109988307-109988329 TCAATGGGCAGAAGCTGGGTGGG - Intergenic
936197415 2:110383176-110383198 TCAATGGGCAGAAGCTGGGTGGG + Intergenic
936948359 2:117951870-117951892 TGCAGGAGGAGAAGGAGGGCTGG - Intronic
937273759 2:120671419-120671441 CGCTTGGGGAGCAGCGGGGCCGG - Intergenic
937740003 2:125339943-125339965 TGGACGGGGAAAAGTTGGGCGGG - Intergenic
940285954 2:152033182-152033204 TGAATGAGGAGAAGCGGGGTGGG + Intronic
940644913 2:156381159-156381181 TGTATGGGTAGTTGCTGGGCTGG + Intergenic
940981261 2:160006197-160006219 TGCACGGGGTAAAGGTGGGCAGG + Intronic
941822033 2:169853224-169853246 TTCATGGAGAAGAGCTGGGCAGG + Intronic
942602129 2:177652351-177652373 TGCATGGGGAGAGGAGGGGAAGG + Intronic
942718468 2:178922015-178922037 TGAATATGGAGAAGCTGGGGAGG + Intronic
943122937 2:183760246-183760268 TGTATGTGCAGAAGCTAGGCTGG - Intergenic
944802368 2:203248733-203248755 AGCCTGGGCAAAAGCTGGGCGGG - Intronic
946836300 2:223776100-223776122 TGGATGAGGAGAGGCTCGGCGGG - Intronic
947533565 2:230927559-230927581 TGGATGGTGAGAGGGTGGGCAGG - Intronic
947594244 2:231400743-231400765 AGGTTGGGGAGAAGCTGGGAAGG - Exonic
947595384 2:231408377-231408399 AGGTTGGGGAGAAGCTGGGAAGG - Intergenic
947707132 2:232285383-232285405 TGCAGGTGGAGAGGCTGGACTGG - Intronic
948102267 2:235384604-235384626 TGAATGGGGATCAGCGGGGCAGG - Intergenic
948681558 2:239638607-239638629 TGCAAGGGGAAATGCAGGGCTGG - Intergenic
948780612 2:240319447-240319469 TGGTTGGGGAGAACCAGGGCAGG - Intergenic
1169194784 20:3677237-3677259 TTCTTGGGGAGAACGTGGGCTGG + Intronic
1169352625 20:4881353-4881375 TGCATGGAGAGAAGGGGGCCAGG + Intronic
1170920938 20:20678882-20678904 TGCATGAGGTGCAGCTGGGCTGG - Intronic
1170989059 20:21285553-21285575 TCCATGGGAGGAATCTGGGCTGG - Intergenic
1171263070 20:23749898-23749920 TGCAAGAGGAGAAACGGGGCTGG + Intronic
1171266365 20:23775180-23775202 TGCAGGAGGAGAAACGGGGCTGG + Intergenic
1171278578 20:23878660-23878682 TGCAGGAGGAGAAACAGGGCTGG + Intronic
1171283663 20:23921177-23921199 TGCAGGAGGAGAAACGGGGCTGG + Intergenic
1171498428 20:25574535-25574557 TGCATGAGGAGGAGGTGGCCTGG - Intronic
1172012095 20:31851476-31851498 TGAATGTGGAGAAGATGGGGTGG + Intronic
1172600136 20:36177681-36177703 TGCTTGGGGAGAAGCTGAAGTGG - Intronic
1172767237 20:37357273-37357295 TGCAGGAGGACAGGCTGGGCTGG + Intronic
1172771855 20:37386688-37386710 TGGATGGGGAGGAGATGTGCAGG - Intronic
1172901799 20:38340560-38340582 TGCAAGGAGAGAAGGTGGGGAGG + Intergenic
1174761300 20:53209698-53209720 TGCTTGGGGAGAAGCTGGTTTGG + Intronic
1175335595 20:58193835-58193857 TGGATGGGAAGAATCTGGCCAGG - Intergenic
1175384855 20:58587633-58587655 AACATGGGGACAAGCTGGGCAGG - Intergenic
1175466374 20:59193145-59193167 AGCATGGGGAGACGGTGGCCAGG + Exonic
1175693875 20:61086562-61086584 TGCAAAGGGAGAAGATGAGCTGG - Intergenic
1176026126 20:62986482-62986504 TGCAGGGGGTGCAGGTGGGCGGG + Intergenic
1176064809 20:63188887-63188909 TGCTTGGGTGGAGGCTGGGCGGG - Intergenic
1176080173 20:63268602-63268624 GGCATGGGGATATTCTGGGCTGG + Intronic
1176087637 20:63305302-63305324 TTCAAGGGGAGCAGCTGGGGTGG + Intronic
1176122018 20:63458252-63458274 AGCATGTGGAGAAGCTGGGTGGG + Intronic
1178913960 21:36696866-36696888 TGCTTGGGCAGCTGCTGGGCAGG + Intergenic
1179403582 21:41107398-41107420 TGCATAGTGAGAGGCAGGGCCGG + Intergenic
1179718791 21:43303809-43303831 AGCATGGGGAGCAGCTGCTCAGG + Intergenic
1180621821 22:17167541-17167563 GGCAAAGGCAGAAGCTGGGCAGG - Intergenic
1181777640 22:25170966-25170988 TGCAAAGGGGGCAGCTGGGCTGG + Intronic
1182423006 22:30257620-30257642 GCCAAGGGGAGAAGCAGGGCCGG + Intergenic
1182452611 22:30430133-30430155 TGCCGGGGGAGAAGATGAGCTGG - Intergenic
1182572245 22:31248224-31248246 GGCAAGGGGTGGAGCTGGGCTGG - Intronic
1183343753 22:37295848-37295870 TGCATGGGAACCACCTGGGCGGG - Intronic
1183482418 22:38072393-38072415 TTGTTGGGGAGAAGCAGGGCAGG - Intronic
1183490001 22:38111091-38111113 GGCAAGTGGAGGAGCTGGGCGGG - Intergenic
1183933335 22:41248458-41248480 TGCATGTGGGGAGGCGGGGCTGG - Intronic
1184696163 22:46140192-46140214 TGCCTGGGGAGCAGCGGGGCTGG + Intergenic
950365262 3:12478979-12479001 TTCATGGGAAGAAACAGGGCAGG + Intergenic
950431948 3:12955817-12955839 CTTATGGGGAGCAGCTGGGCAGG - Intronic
951080442 3:18445201-18445223 GCCAGGGGGAGAAGCCGGGCGGG - Intronic
952882592 3:37994161-37994183 GCCATGGGGAGACGCTAGGCAGG - Intronic
953383271 3:42490147-42490169 TGCATGGGGAGGAATTGGGGTGG - Intronic
953448339 3:42986571-42986593 TGGCTGGGAAGGAGCTGGGCTGG + Intronic
954228559 3:49199180-49199202 TGCATGGGGTGCACGTGGGCTGG + Intronic
954574699 3:51669516-51669538 AGCCTGAGGTGAAGCTGGGCAGG + Intronic
954801051 3:53187008-53187030 TGAATGGGGAGAAGCAGGTCTGG - Intronic
955054628 3:55444628-55444650 TGCTTGGGGAGAGGCTGTGGAGG + Intergenic
955197909 3:56822526-56822548 TACATGTGGAAAAGCTTGGCAGG + Intronic
955391596 3:58526219-58526241 TGCCTGTGGAGAAGCAGGACAGG + Intronic
955796659 3:62644481-62644503 TGGATGGGGAGTGGGTGGGCAGG - Intronic
956359546 3:68432186-68432208 AGGTTGGGGAGAAGCTGGGAAGG + Intronic
956732648 3:72210959-72210981 CGTATGGGGACAAGCAGGGCTGG - Intergenic
957041746 3:75341184-75341206 TGGATGGGGAGAAGCTGGGAAGG + Intergenic
957080776 3:75633959-75633981 GGCCTGGGGAAAAGCAGGGCTGG + Intergenic
957181929 3:76889777-76889799 TGCTTGGGGAAAAGCTGGTTGGG + Intronic
957756990 3:84502695-84502717 TGCATGGTGAGAAGATGTGGAGG + Intergenic
960155684 3:114295242-114295264 TGGGTGGGGAGGAGATGGGCTGG + Intronic
960702372 3:120451046-120451068 AGAATGGGGAGGAGCTGGGGGGG - Exonic
960747654 3:120908111-120908133 TGCCGGGGAAGAAGCAGGGCGGG + Exonic
961046460 3:123711977-123711999 TGGATGGGGAGAGGCTGGGAAGG + Intronic
961208946 3:125110403-125110425 TGCATGGGGTGCAGGTGGGTGGG - Intronic
961827499 3:129606672-129606694 TGCATGGGGCGAGGCGCGGCCGG + Exonic
962376530 3:134863005-134863027 TTCCTGGAGAGAAGCTGGGGTGG + Intronic
966076437 3:175940965-175940987 TGGCTGGGGTAAAGCTGGGCAGG - Intergenic
966819381 3:183913091-183913113 TGCTGGGGGATAAGCTGAGCTGG + Intergenic
966929068 3:184664040-184664062 TGCATGGGAAGCAGGCGGGCGGG + Intronic
967825933 3:193877350-193877372 TGGCTGGGGAGAAGGTGGGCAGG + Intergenic
968520123 4:1031362-1031384 TGACTGGGGAGAAGGGGGGCTGG + Intergenic
968867917 4:3225573-3225595 TGTCTGGGCAGGAGCTGGGCTGG + Intronic
968939554 4:3630901-3630923 GGCAGGGGAAGAAGCTGGGGCGG + Intergenic
968969629 4:3786819-3786841 GGCCTGGGGTGAAGCTGGCCTGG - Intergenic
969577936 4:8047286-8047308 GGCATGGAGAGGACCTGGGCCGG - Intronic
969611434 4:8229602-8229624 TGGATGGTGAGAAGCTCTGCTGG + Intronic
969613590 4:8240084-8240106 TGCCTGGGGAGAAGCTGGGTGGG + Intronic
970379087 4:15488682-15488704 TTCAAGGTGAGGAGCTGGGCTGG - Intronic
970754441 4:19408081-19408103 TGCATTTGGAGAAACTAGGCAGG + Intergenic
971069403 4:23074019-23074041 CACATGGGGAGAAGATGGCCAGG + Intergenic
972379707 4:38508021-38508043 TTCCTGTGGAGAAGCAGGGCAGG + Intergenic
974081309 4:57216162-57216184 TGCATGGCAGGAAGCTGGACTGG - Intergenic
976061680 4:81136156-81136178 TGAATGGGGAGAACCTGGAAGGG - Intronic
976460620 4:85307754-85307776 TGATTGGGTACAAGCTGGGCAGG - Intergenic
977557384 4:98499210-98499232 TGCCCGGGCAGAAGCTGGGGTGG - Intronic
978831299 4:113088341-113088363 GGCAAGGGGACAAGCTGGGGAGG + Intronic
979403911 4:120285380-120285402 AGCATGGAGAGAAGCAGGGAGGG + Intergenic
979475873 4:121157085-121157107 TGCAGCGGGAGGAGGTGGGCGGG - Exonic
981090022 4:140722576-140722598 TGAGTGGGGAGAAGCTAGGCTGG + Intronic
981342227 4:143634700-143634722 TAGAAAGGGAGAAGCTGGGCTGG + Intronic
981354654 4:143774402-143774424 TGCAGGGGGGAAAGCTGGGTGGG + Intergenic
982996163 4:162349374-162349396 TGCGTGAGGAGAAGGTGGTCAGG - Intergenic
983438116 4:167742984-167743006 TGAATAGGGAAAAGCTGTGCAGG + Intergenic
985085140 4:186305616-186305638 TGCATGGGGCCAGGCTGGGGCGG - Intergenic
985843625 5:2328406-2328428 TGAATGGGGAAAAGAGGGGCAGG + Intergenic
985905553 5:2832624-2832646 TTCATGGGGAGGAGCCGGGATGG - Intergenic
985913454 5:2900547-2900569 GGAGTGGGGAGAAGCTGGGGAGG - Intergenic
985913487 5:2900676-2900698 GGGGTGGGGAGAAGCTGGGGAGG - Intergenic
985995126 5:3593491-3593513 TGGGTGGGGAGGAGCTGGGTGGG - Intergenic
989114382 5:37938334-37938356 AGCATGTGTATAAGCTGGGCAGG - Intergenic
992267667 5:75034338-75034360 TGCAGGGGGTGGAGGTGGGCTGG + Intergenic
992618046 5:78564170-78564192 TCCCTTGGGAGAAGCAGGGCTGG + Intronic
992873448 5:81028826-81028848 AGCATGAGCAGAAGCAGGGCAGG + Intronic
997381604 5:133441976-133441998 ACAATGGTGAGAAGCTGGGCTGG + Intronic
998215884 5:140238413-140238435 TGGAAGGACAGAAGCTGGGCTGG + Intronic
999174561 5:149622937-149622959 TGGATGGGGAAAAGCTGAGCTGG - Intronic
999381897 5:151127172-151127194 TGCAGGAGGAGATGCAGGGCTGG - Intronic
999525944 5:152405437-152405459 TGAATGGGAAGGAGCTGGGAAGG + Intronic
1000047490 5:157533552-157533574 CTCATGGGGAGAAGAGGGGCCGG + Intronic
1000349699 5:160343815-160343837 TGCAAGGGGAGAAGATGAGGGGG - Intronic
1001556383 5:172640469-172640491 GGCATAGGGAGAATCTGGGGTGG - Intergenic
1001940364 5:175735864-175735886 AGGATGGGGAGAAGCTGGGTGGG - Intergenic
1002000667 5:176194830-176194852 TGCAAGGGCAGGAGCGGGGCGGG + Intergenic
1002066910 5:176656498-176656520 TGATAGGAGAGAAGCTGGGCAGG + Intronic
1002253672 5:177944151-177944173 TGCAAGGGCAGGAGCGGGGCGGG - Intergenic
1002525121 5:179811328-179811350 TGCAGGGGGAGGAGCTATGCAGG + Intronic
1002525126 5:179811345-179811367 TGCAGGGGGAGGAGCTATGCAGG + Intronic
1002525136 5:179811378-179811400 TGCAGGGGGAGGAGCTATGCAGG + Intronic
1002525141 5:179811395-179811417 TGCAGGGGGAGGAGCTATGCAGG + Intronic
1002671048 5:180867645-180867667 AGGTTGGGGAGAAGCTGGGAAGG - Intergenic
1002789489 6:426934-426956 TGCCTTGGCAGAAGCAGGGCAGG - Intergenic
1002792527 6:446631-446653 AGCATGAGCAGAAGCTGGACAGG - Intergenic
1002880029 6:1242967-1242989 TGCCTGGGAAGAAGCAGAGCTGG + Intergenic
1004144016 6:13047887-13047909 TGCAGCGGGAGGAGCTGGGCCGG - Intronic
1004917415 6:20344948-20344970 TGAAGTGGGAGAAGCTTGGCTGG - Intergenic
1006106535 6:31720247-31720269 TACCTGGGGATAAGCTGAGCTGG + Intronic
1006277496 6:33017338-33017360 TGCAAGGAGAGAAGATGGCCTGG + Intergenic
1006369415 6:33634662-33634684 GGCATGGGGAGGGGCTGAGCTGG + Intronic
1006763928 6:36488124-36488146 TACATGGAGTGAAGCTGGGTGGG + Exonic
1007169843 6:39855127-39855149 GGGATGGGGAGAATCTTGGCTGG + Intronic
1007180484 6:39925999-39926021 GGCCTGGGGAGATGCTGGCCTGG - Intronic
1007336731 6:41159927-41159949 GGCAGGGGGAGAACCTTGGCGGG + Intronic
1008227634 6:48940782-48940804 TGCTTGGGTAGGAGCTGAGCAGG + Intergenic
1010765998 6:79778026-79778048 TGGAAGGGGAGAACCTGGGAAGG - Intergenic
1012352177 6:98265946-98265968 TGGCTTGGGAGCAGCTGGGCAGG + Intergenic
1015598978 6:134894119-134894141 AGAATGGGGAGCAGCTGGGTTGG + Intergenic
1015719556 6:136227338-136227360 TGCATGGGGAAAACTAGGGCTGG - Intergenic
1015938321 6:138424491-138424513 TGCTTGGGGAGCAGCTTGACGGG + Exonic
1016474899 6:144416501-144416523 TGCAAGGGGAGAAGCCAGGGGGG - Intronic
1017524608 6:155231623-155231645 TGCTTGGGGGGAAGCTGGCAGGG - Intronic
1017642979 6:156512456-156512478 GGCTTGGGGAGAAGCTGGAGTGG - Intergenic
1019299733 7:296988-297010 GGCAGGAGGAGAAGCTGGGAGGG + Intergenic
1019299769 7:297110-297132 GGCAGGAGGAGAAGCTGGGAGGG + Intergenic
1019463208 7:1172439-1172461 TGAGTAGGGGGAAGCTGGGCAGG - Intergenic
1019632606 7:2057944-2057966 GGCATGGAGAGAAGCAGGGCCGG + Intronic
1020003408 7:4768523-4768545 TGCCTGAGGAGGAGCTGGGACGG - Exonic
1021588075 7:22231402-22231424 TGGATAGGGAGATGCTGGGAAGG - Intronic
1022374582 7:29801657-29801679 GGGATGGGGAGCAGATGGGCAGG - Intergenic
1024228466 7:47346237-47346259 TGCATGGGGAAAGGCTGGTGTGG - Exonic
1024294168 7:47829742-47829764 TGCCTGGTGAGTAGTTGGGCTGG - Intronic
1024983871 7:55179530-55179552 CTCCTGGGGAGAAGGTGGGCAGG + Intronic
1025798985 7:64766492-64766514 AGCATAGGGTGAATCTGGGCAGG - Intergenic
1026593885 7:71718171-71718193 GGGTTGGGGAGAAGCTGGGAAGG + Intergenic
1026794036 7:73354397-73354419 TGGGTGGGGAGAAGCAGGTCAGG + Intronic
1027007472 7:74707436-74707458 TAGATGGGGTGAAGCGGGGCAGG - Intronic
1027629372 7:80583577-80583599 TGTGTGGGAAGAAGCTGGGAAGG - Intronic
1029017002 7:97325528-97325550 TGGAGGGGGAGCAGATGGGCAGG + Intergenic
1029247994 7:99216444-99216466 TGTATAGGGAGCAGCTGAGCTGG - Intergenic
1029951013 7:104585563-104585585 TGCATGGTGAGGATTTGGGCAGG + Intronic
1030669348 7:112318091-112318113 TGGATGGGAGGAAACTGGGCTGG - Intronic
1030700819 7:112638385-112638407 TGGGTGGGGAGATGCTGGGAAGG + Intergenic
1032284442 7:130530219-130530241 TTGATGGGGAGCAGATGGGCAGG + Intronic
1034256219 7:149725972-149725994 TGGATGAGGAGAAGCTGGTGGGG - Exonic
1034390690 7:150785283-150785305 TGGACGGGGAGGAGCTGGGGAGG - Intergenic
1034901384 7:154909971-154909993 AGCATGAGGAGGGGCTGGGCTGG + Intergenic
1035019054 7:155789472-155789494 CCCATGAGGAGAAGCTGTGCCGG + Intergenic
1035317462 7:158005631-158005653 TGCAGGGGGAGGTGCAGGGCAGG + Intronic
1036188327 8:6645170-6645192 TGGGTGGGCAGAGGCTGGGCTGG - Intergenic
1038010916 8:23475157-23475179 TGCATGGGGAGAGGCTGCCTGGG + Intergenic
1039208541 8:35184796-35184818 TGAATGAGGAAAGGCTGGGCTGG - Intergenic
1040450349 8:47539861-47539883 TCCATGGTGGGAAGCTGGCCTGG + Intronic
1040562198 8:48532940-48532962 TGCAAGGCGAGAAGCCTGGCTGG - Intergenic
1040972464 8:53151727-53151749 TGCATGGCGAGAAGCTGCCAAGG - Intergenic
1042483257 8:69326117-69326139 CACATGTGGAGAAGGTGGGCTGG + Intergenic
1043127220 8:76414182-76414204 TGGATGGTGAGAAGATGGGATGG + Intergenic
1043395285 8:79829411-79829433 AGCATGTGGAGAAGCTTGGAAGG + Intergenic
1043756187 8:84006105-84006127 TGCAGCGGGAGAGGCTCGGCTGG - Intergenic
1044694599 8:94910062-94910084 TGCATAGGGGTAAGGTGGGCGGG + Intronic
1047373020 8:124271839-124271861 GCCATGGGAAGAAGCTGGGATGG - Intergenic
1047517536 8:125568241-125568263 TGCAGGAGGAGCAGCTGGGCAGG + Intergenic
1049348815 8:142153197-142153219 AGCATGGAGAGAAGCTGGCGAGG + Intergenic
1049573252 8:143379253-143379275 TGCATGGGGCAGAGATGGGCAGG + Intronic
1049632406 8:143665726-143665748 GGGATGGGGATAAGGTGGGCGGG + Intergenic
1049881810 8:145069804-145069826 AGATTGGGGAGAAGCTGGGAAGG + Intergenic
1050396399 9:5202536-5202558 TCAATGGGAAGAAGCTGTGCAGG - Intergenic
1050846441 9:10226490-10226512 TGCATGAGGTGAAGCAGTGCAGG + Intronic
1051689833 9:19699212-19699234 TGCATGGGGACAAGAACGGCTGG + Intronic
1051870705 9:21734758-21734780 TTCTTGGGGAGGAGCTGGGCAGG - Intergenic
1053274203 9:36771045-36771067 TTCTTGGGGAGGAGCTGGACAGG - Intergenic
1055811425 9:80153167-80153189 TGCATGGGGAGAAGCACAACCGG - Intergenic
1056000444 9:82210666-82210688 TGTAGGGGCACAAGCTGGGCTGG + Intergenic
1056406764 9:86282501-86282523 TCCATGGAGAGAAGCTGAGGCGG - Exonic
1056516179 9:87352625-87352647 TTCAGGGGGAGAAGGAGGGCAGG + Intergenic
1056852827 9:90098464-90098486 CACATGGAGAGGAGCTGGGCTGG - Intergenic
1057889917 9:98862159-98862181 TGCATGTGGAGGAGCAGGTCTGG - Intergenic
1058216716 9:102242984-102243006 TGTAAGGTGAGAAGATGGGCAGG - Intergenic
1059345922 9:113627935-113627957 TCCATGGGGGTAAGATGGGCTGG - Intergenic
1059466868 9:114474445-114474467 TGCAGGCTGAGATGCTGGGCTGG - Intronic
1060053949 9:120397307-120397329 ATCTTGGGGAGAAGATGGGCAGG - Intronic
1060665526 9:125430094-125430116 TGCCTGGGGAAAAGCTGCCCCGG - Intergenic
1061888436 9:133605142-133605164 TGCGTGGGGTGGAGCTGGCCTGG + Intergenic
1061969485 9:134036186-134036208 TGCCCGGGGAGAAGCTGGGCCGG - Exonic
1062163457 9:135092971-135092993 TTCATGGGCAGAAGCAGGACAGG + Intronic
1062316660 9:135970646-135970668 TGCCTGGGGAGAAGCTTTGTGGG - Intergenic
1062489937 9:136800165-136800187 TGCAGGTGGAGAGGCGGGGCTGG + Exonic
1187310054 X:18133228-18133250 TGCACGGTGAGATGCTGGGGTGG - Intergenic
1187454553 X:19429711-19429733 TGGATGGAGAGAAGGTGGGGAGG + Intronic
1189125475 X:38441301-38441323 TTCATGGGGAGGAGCTGGTCTGG + Intronic
1189204092 X:39222694-39222716 TGCATAGGGAGAGCCTGGGAGGG - Intergenic
1190580814 X:51892368-51892390 TTTATGGAGAGAAACTGGGCTGG - Intronic
1192205799 X:69095248-69095270 TGCAAGATGAGGAGCTGGGCTGG + Intergenic
1195001177 X:100644765-100644787 AGATTGGGGAGAAGCTGGGCAGG + Intronic
1196401392 X:115320541-115320563 TGCTTGGGGAGAAGTGGGGATGG + Intergenic
1200077351 X:153557711-153557733 TGCATGGGGACACCCTGGGCGGG - Intronic
1200135343 X:153872005-153872027 GGCCAGGGGAGAAGCTGGGGTGG + Intronic
1200849107 Y:7864445-7864467 TGCATTGTTAGAAGCTGGGAAGG + Intergenic
1201718919 Y:17076237-17076259 TCCATGGGGAGATACTGGACTGG - Intergenic