ID: 1150221224

View in Genome Browser
Species Human (GRCh38)
Location 17:63496950-63496972
Sequence TGGGCTGGCCGCAGTACAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221215_1150221224 26 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 52
1150221217_1150221224 9 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221224 Original CRISPR TGGGCTGGCCGCAGTACAAC TGG Exonic
900371266 1:2333234-2333256 TGGGCTGGCCCCGCTGCAACAGG + Intronic
900661243 1:3785101-3785123 GGGGCCGGGCGCAGTACAGCAGG + Exonic
906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG + Intronic
911717039 1:101144816-101144838 TGGGATGGCAGTGGTACAACTGG + Intergenic
920497669 1:206467072-206467094 TGGGCAGGATGCAGTAGAACGGG + Intergenic
921100877 1:211928592-211928614 TAGGCTGGGCTCATTACAACAGG + Intergenic
921293901 1:213683984-213684006 TGAGCTGGCCTCAGTAAATCAGG - Intergenic
1064410005 10:15097005-15097027 TAGGCTGGCCTCCGAACAACTGG + Intronic
1066402363 10:35088892-35088914 TGGGCTGGGCGCAGTAGCTCAGG + Intronic
1072099650 10:92216835-92216857 TGGGCTGACGGCAGGACGACTGG + Intronic
1077933037 11:6753496-6753518 TGGGGTGGCTGCACTAAAACAGG - Intergenic
1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG + Intronic
1097132996 12:56827373-56827395 TGGGCTGGCCTGAGTAGAAAAGG + Intergenic
1104202277 12:126601268-126601290 TGGGCTGGCCAAAATACACCAGG - Intergenic
1105308065 13:19182713-19182735 TGGGCTGGGCGCAGTGCCTCAGG + Intronic
1106256056 13:28022891-28022913 TGGGCTGGCAGCAGTCCTGCAGG - Intronic
1118810068 14:69266795-69266817 TGGGCTGGCCTCAGTGCATGGGG - Intronic
1120837908 14:89057584-89057606 TGGGCTGACCCCTGTACCACAGG + Intergenic
1127070280 15:55282205-55282227 TGGATTGTCCACAGTACAACTGG + Intronic
1132242569 15:100269890-100269912 TGGGCTGGCTGAAGTAGAAAAGG - Intronic
1134394694 16:13852259-13852281 TGGGCTGCCTCCAGTACCACTGG + Intergenic
1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG + Intronic
1141833281 16:86521716-86521738 TGGGCTGGCCGCAGGTCACGGGG + Intergenic
1148166837 17:45489967-45489989 TGGGCTGTCCTCAGTACGGCAGG + Intronic
1150010570 17:61498806-61498828 TCTGATGGCCGCAGTACAAAAGG + Intergenic
1150218801 17:63484482-63484504 TGGGCTGGCCCGAGTACCAGTGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG + Intergenic
934574251 2:95390524-95390546 TGGGCTGGCAGCAGTGCCTCTGG - Intergenic
934656965 2:96121432-96121454 TGGGCTGGAAGCAGAACAGCCGG - Intergenic
936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG + Intergenic
948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG + Intronic
948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG + Exonic
1179800452 21:43809343-43809365 TGGGCTGGCAGGACTGCAACTGG - Intergenic
949471546 3:4401807-4401829 TGGGATGGCAGCAGTTCAGCAGG - Intronic
950703965 3:14768725-14768747 TGGGCTAGCCGCAATACCATGGG + Intronic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG + Intronic
974992052 4:69105035-69105057 TTGGCTGGGCGCAGTCCAGCAGG - Intronic
976359789 4:84164214-84164236 TTGGCTGGCCGCAATACAGCTGG - Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
1002283900 5:178149649-178149671 TGGGCTGGCAGCAGGACGACTGG - Exonic
1023778595 7:43634628-43634650 TGGGGAGGCCTCATTACAACAGG + Intronic
1024118479 7:46214485-46214507 TGCTCTGGCCCCAGTACATCTGG - Intergenic
1028608467 7:92681632-92681654 TGAGTTGGCTGAAGTACAACTGG + Intronic
1029494372 7:100889283-100889305 TGGACTGGCCGCCGTACAGGCGG - Exonic
1031961421 7:127993574-127993596 TGGGATGGCCGCAGTTGAACTGG + Intronic
1035689716 8:1552088-1552110 GTGGCTGGCTGCAGAACAACAGG - Intronic
1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG + Intergenic
1040485654 8:47869134-47869156 TGGGCTGGGCTCAGAACAAGTGG + Intronic
1049434520 8:142580190-142580212 TGGGCTGGCCACAGGGCAAGGGG - Intergenic
1056792579 9:89635650-89635672 TGGGCTGGCTGCTGTTCAAGTGG - Intergenic
1060886799 9:127160356-127160378 TGGGCTGGCCTCAACACAAGGGG - Intronic
1186257153 X:7734503-7734525 GGGGATGGCCACAGTAGAACTGG + Intergenic
1192440416 X:71169833-71169855 GGAGCTGGCAGCATTACAACTGG + Exonic
1192541246 X:71975086-71975108 TATGCTGGCCGCAGGACTACTGG + Intergenic
1196775560 X:119333929-119333951 GGGACTGGCCGCAGTAGAGCAGG - Intergenic