ID: 1150221224

View in Genome Browser
Species Human (GRCh38)
Location 17:63496950-63496972
Sequence TGGGCTGGCCGCAGTACAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221215_1150221224 26 Left 1150221215 17:63496901-63496923 CCGCTGCTGGACTGGCTCCGCAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 52
1150221217_1150221224 9 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221224 Original CRISPR TGGGCTGGCCGCAGTACAAC TGG Exonic