ID: 1150221226

View in Genome Browser
Species Human (GRCh38)
Location 17:63496964-63496986
Sequence TACAACTGGACGCCGAACTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150221217_1150221226 23 Left 1150221217 17:63496918-63496940 CCGCACGGAGAACGAGCTGCATG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1150221226 17:63496964-63496986 TACAACTGGACGCCGAACTCCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150221226 Original CRISPR TACAACTGGACGCCGAACTC CGG Exonic
901830356 1:11888366-11888388 TAGAACTGGAAGTCGAACACAGG + Intergenic
1065792248 10:29271438-29271460 GACAGCTGGAAGCCTAACTCTGG - Intergenic
1069895754 10:71679194-71679216 TTCAACTGGAGGCCGCACTCTGG - Intronic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1086575814 11:88337891-88337913 TGCAACTGGACCCAGAACTAGGG + Intergenic
1101906049 12:108827379-108827401 TACAACTGCCCTCCGAGCTCTGG + Intronic
1133370335 16:5241261-5241283 GTCACCTGGACACCGAACTCAGG + Intergenic
1134889397 16:17825699-17825721 CAGAACTGGACTCCGAAGTCAGG - Intergenic
1143423093 17:6811636-6811658 CACAACTGGACTCTGAGCTCTGG + Intronic
1146841590 17:36160147-36160169 TAGAACTGGAAACCGAACACAGG + Intergenic
1146853901 17:36248107-36248129 TAGAACTGGAAACCGAACACAGG + Intronic
1146869808 17:36371999-36372021 TAGAACTGGAAACCGAACACAGG + Intronic
1146877163 17:36423080-36423102 TAGAACTGGAAACCGAACACAGG + Intronic
1147072687 17:37972623-37972645 TAGAACTGGAAACCGAACACAGG + Intergenic
1147084209 17:38052161-38052183 TAGAACTGGAAACCGAACACAGG + Intronic
1147100157 17:38176127-38176149 TAGAACTGGAAACCGAACACAGG + Intergenic
1150221226 17:63496964-63496986 TACAACTGGACGCCGAACTCCGG + Exonic
1155787301 18:29916467-29916489 TACAACTGGAAGCGAAACTGTGG - Intergenic
1158117451 18:54011752-54011774 TACAACTGGAATGCAAACTCAGG - Intergenic
1162869542 19:13575180-13575202 AACAACTGCACGCTGAGCTCAGG + Intronic
942199148 2:173553567-173553589 CACAACTGGAAGCAGAAATCTGG - Intergenic
947115840 2:226769325-226769347 TACACATGGACACTGAACTCAGG + Intronic
948266800 2:236640967-236640989 TACAACGGGACTCAGAAGTCAGG + Intergenic
1175052513 20:56168358-56168380 TACAGGTGGACGCCTGACTCAGG - Intergenic
960000026 3:112721697-112721719 TACAACTGTCCACCTAACTCAGG + Intergenic
992749230 5:79847288-79847310 TACAACTGTACGCAGAAATATGG + Intergenic
996105990 5:119503992-119504014 TACAAGTGGGAGCTGAACTCTGG - Intronic
1004811160 6:19265113-19265135 TATAACTGGAAACTGAACTCAGG + Intergenic
1012069606 6:94596839-94596861 TAAAACTGGACCCCTAACTGGGG - Intergenic
1012753218 6:103189908-103189930 TCCAACAGGAGGCAGAACTCAGG - Intergenic
1013099915 6:106977464-106977486 GACAACTGGAGGCCCAACACAGG + Intergenic
1017648694 6:156562273-156562295 TCCAACTGGAAACCCAACTCAGG - Intergenic
1059609992 9:115882229-115882251 TACAACTTGAAGCAGAATTCAGG + Intergenic
1187746384 X:22413810-22413832 TACAATAGGAAGCCTAACTCTGG + Intergenic
1197853338 X:130888402-130888424 TAGAACTGGAAGCTGAACCCAGG - Intronic