ID: 1150223245

View in Genome Browser
Species Human (GRCh38)
Location 17:63508946-63508968
Sequence TGGGTCTTCTTTGGCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150223245_1150223249 -9 Left 1150223245 17:63508946-63508968 CCCGTTTTGCCAAAGAAGACCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1150223249 17:63508960-63508982 GAAGACCCAGACGGTCAGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 86
1150223245_1150223252 -1 Left 1150223245 17:63508946-63508968 CCCGTTTTGCCAAAGAAGACCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1150223252 17:63508968-63508990 AGACGGTCAGCGAGGTTGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150223245_1150223254 19 Left 1150223245 17:63508946-63508968 CCCGTTTTGCCAAAGAAGACCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1150223254 17:63508988-63509010 TGGCTTCCCTAGAAGGCGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 74
1150223245_1150223253 12 Left 1150223245 17:63508946-63508968 CCCGTTTTGCCAAAGAAGACCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1150223253 17:63508981-63509003 GGTTGAGTGGCTTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 95
1150223245_1150223255 20 Left 1150223245 17:63508946-63508968 CCCGTTTTGCCAAAGAAGACCCA 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1150223255 17:63508989-63509011 GGCTTCCCTAGAAGGCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150223245 Original CRISPR TGGGTCTTCTTTGGCAAAAC GGG (reversed) Intronic
906277202 1:44525285-44525307 GGGGCCACCTTTGGCAAAACGGG + Intronic
906383169 1:45345664-45345686 TGTTTCTTCATTGGTAAAACAGG - Intronic
907318233 1:53586179-53586201 TGGGTTTGCTTTTCCAAAACAGG + Intronic
908534337 1:65065222-65065244 AGGGTCTTCTCTGGCAACTCTGG + Intergenic
908581331 1:65520300-65520322 TGGGTATTCTCTGGGCAAACCGG - Intronic
908667223 1:66506894-66506916 TGGGTCTTCTTTTGGAAAATGGG - Intergenic
910437827 1:87223128-87223150 TGGGTTTTCTTTGGCAATTATGG + Intergenic
911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG + Intronic
911239639 1:95451120-95451142 TGGGTCTTATTTATTAAAACAGG + Intergenic
914735112 1:150408853-150408875 TCTGTCTTCATTTGCAAAACAGG - Intronic
915307593 1:154989558-154989580 AGGGTCTTCTTTGGGGAAAAAGG + Exonic
916298243 1:163244234-163244256 TGGGTCTTCTTTTGTTAAAATGG - Intronic
918128955 1:181608247-181608269 TGGGTATTATTTGGGAAGACAGG + Intronic
919789619 1:201282897-201282919 TGGGTATGCCTTGGTAAAACCGG - Intergenic
919832696 1:201553014-201553036 GGGGTTTTGTTTGGCAACACTGG + Intergenic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
923654338 1:235902234-235902256 CGAGTCTTCTTTGACTAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063780562 10:9318010-9318032 TGGTTCATCTTTGTCATAACAGG - Intergenic
1067892804 10:50150829-50150851 TGGCTCTTCTTTGGCAAACTGGG + Intergenic
1070253900 10:74797702-74797724 TGGTTCCTCTTTGGTAAAAGTGG + Intergenic
1071830105 10:89363077-89363099 TGCCTCTTCTTTGATAAAACTGG - Intronic
1072597390 10:96887235-96887257 TGGGCATTCTTAGGTAAAACTGG - Intronic
1073282827 10:102367224-102367246 TGGGTCTTCTTTGCCTTGACTGG - Intronic
1074312392 10:112333424-112333446 TGGGTCTTCATGGGCAACCCTGG - Intergenic
1076514782 10:131037867-131037889 TGGTTCTCATTTGCCAAAACTGG - Intergenic
1077238333 11:1495671-1495693 TGGGTCTTCTTTTGCAAGAATGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084559901 11:69898390-69898412 GGGGGCTTCTTTGGCCAAATTGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1088296540 11:108302866-108302888 AGGGTTTTCTTTGTCAAATCTGG - Exonic
1089904561 11:122025037-122025059 TTGCTCTTCTGTGGCAAAAATGG + Intergenic
1092003599 12:5050637-5050659 TGGTTCTTCTCTGGCTATACAGG + Intergenic
1092132238 12:6120663-6120685 TGGTTCTCCATTGGTAAAACTGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1101584229 12:106070622-106070644 AGTGTCATCCTTGGCAAAACTGG - Intronic
1107066534 13:36219564-36219586 TTGGTCTGCTATGGCATAACAGG - Intronic
1107069921 13:36258194-36258216 GGGGGCTTCTTTGGCCAAATTGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1110266177 13:73540408-73540430 TTTGTCTTCTTTGGTAAAGCTGG + Intergenic
1110533347 13:76622598-76622620 TGGAACTTCTTTTGTAAAACAGG - Intergenic
1112048771 13:95624167-95624189 TGAGTCTTCTTTGGGGAAAACGG - Intronic
1112996362 13:105579001-105579023 TGGGTCTTGATTGGCAATTCTGG - Intergenic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1116954627 14:50911378-50911400 TTGGTGTTCTCTTGCAAAACTGG + Intronic
1121796540 14:96740849-96740871 TGGGTCTTTTTTGGCCAACGAGG - Intergenic
1122274169 14:100582764-100582786 TGGGTCTTCCAGGGCAAAGCGGG + Intronic
1122479278 14:102035646-102035668 TGGGTAGTCTTTGCCAACACAGG + Intronic
1123495651 15:20822669-20822691 TGGGTTTTATTTGTCAAAATGGG + Intergenic
1123552138 15:21391761-21391783 TGGGTTTTATTTGTCAAAATGGG + Intergenic
1123588382 15:21829158-21829180 TGGGTTTTATTTGTCAAAATGGG + Intergenic
1127252040 15:57248901-57248923 TGCATCTGCTTTTGCAAAACAGG - Intronic
1128822844 15:70676336-70676358 TGTTGCCTCTTTGGCAAAACTGG - Intronic
1129095210 15:73199857-73199879 TGTGTCTTCCGTGGCAAAAGGGG + Intronic
1129752425 15:78075716-78075738 TTGGTTTTCTTTGGGGAAACAGG + Intronic
1202960486 15_KI270727v1_random:118992-119014 TGGGTTTTATTTGTCAAAATGGG + Intergenic
1132868601 16:2105611-2105633 TGTTTCTTCATGGGCAAAACAGG + Intronic
1133693846 16:8241981-8242003 TGTGTAATCTTTGGCAAAACAGG - Intergenic
1134159561 16:11875855-11875877 TTGATCTTGTTTGACAAAACGGG + Exonic
1134522986 16:14927048-14927070 TGTTTCTTCATGGGCAAAACAGG - Intronic
1134549640 16:15133010-15133032 TGTTTCTTCATGGGCAAAACAGG + Intronic
1134644319 16:15854225-15854247 TGGCTCATCTTTGGCAGAACCGG - Intronic
1134710653 16:16325699-16325721 TGTTTCTTCATGGGCAAAACAGG - Intergenic
1134718824 16:16369987-16370009 TGTTTCTTCATGGGCAAAACAGG - Intergenic
1134948948 16:18342946-18342968 TGTTTCTTCATGGGCAAAACAGG + Intergenic
1134955932 16:18382172-18382194 TGTTTCTTCATGGGCAAAACAGG + Intergenic
1135815021 16:25624600-25624622 TGGGGCTTCTCTTGAAAAACCGG + Intergenic
1138195253 16:55047096-55047118 TGGGGCTTCTTTGGAAAACTTGG + Intergenic
1138644899 16:58417544-58417566 AGTGTCTCCTTTGGCAAAATTGG + Intergenic
1147673252 17:42189054-42189076 AGGGTCTGCTTTGGGGAAACGGG - Intronic
1147836021 17:43332428-43332450 TGGGTCTTTTCTGACAAATCAGG - Intergenic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1156465303 18:37344991-37345013 TGGGTCATCTCTGGACAAACAGG - Intronic
1157346820 18:46845111-46845133 TGGTTCTTATTTAGCAAAACTGG + Intronic
1159698471 18:71591789-71591811 TGGATCTTCTTTTGAAACACTGG - Intergenic
1160689392 19:454370-454392 TGGCTCTGGTTTGGCAGAACAGG - Intronic
1161862475 19:6808388-6808410 TGGGTCATCCTTGGCAAACTAGG + Intronic
1162351052 19:10149772-10149794 TGGTGCTATTTTGGCAAAACAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167746048 19:51352423-51352445 TGGGTCTGCCTTGGTAACACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925769045 2:7264738-7264760 TGAATCTTCTTTGGAAAAATGGG - Intergenic
926021358 2:9498331-9498353 TGGGTTTTCTTTGGCATTATTGG - Intronic
927387718 2:22555082-22555104 TGTGTCTTCTTTCACAAAACAGG + Intergenic
929554521 2:42917296-42917318 TGGGACTTTTTGGGCAGAACTGG + Intergenic
932893527 2:75616439-75616461 TGTGTCCTCATTGGGAAAACAGG - Intergenic
936708654 2:115105084-115105106 TGAGTCATCTTTGGCAAACTAGG - Intronic
938945509 2:136208595-136208617 TGGTTCTGCCTTGGGAAAACTGG - Intergenic
938946525 2:136217279-136217301 TGGGTTTTCATTCCCAAAACTGG - Intergenic
940552158 2:155173274-155173296 TAGGACTTCTTTGGCTAAAATGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942284532 2:174402045-174402067 TGGGTGTTATTTTTCAAAACAGG + Intronic
946030620 2:216701251-216701273 TGTGTCTTCTTTAGTAAAATAGG + Intergenic
946085150 2:217163417-217163439 TGTGGCTTCTTTGGCTTAACTGG - Intergenic
947707749 2:232290355-232290377 AGGGTCTCCTTTAGCAGAACAGG - Intronic
947920922 2:233873265-233873287 TGTGTCTTATTTGGCTAAAAGGG - Intergenic
1169289341 20:4335325-4335347 TGGGTTTGTTTTGGAAAAACAGG - Intergenic
1169964877 20:11205660-11205682 TGGAAGTTCTTTGGCTAAACTGG + Intergenic
1171943427 20:31353299-31353321 TAGTTCTTCTGTGGCCAAACAGG + Intergenic
1172450886 20:35021816-35021838 TGGTTCTTCTTTTAAAAAACGGG - Intronic
1173304509 20:41835500-41835522 TAGGTTGTCTTTGGCTAAACTGG + Intergenic
1173841158 20:46158103-46158125 TGTTTCTTCTTCTGCAAAACAGG - Intergenic
1173913623 20:46689493-46689515 TGGGACTTCTTCGGCAATCCTGG + Exonic
1175381036 20:58564513-58564535 TGGGTCTGCTGTGGCCACACTGG + Intergenic
1182914857 22:34020079-34020101 TGCATCTTCTTTGACAGAACAGG - Intergenic
952685598 3:36144511-36144533 TGTGTCTTCTTTTGGAAAATAGG - Intergenic
953974966 3:47375524-47375546 TGGGTTTTCTTTGGACAAGCTGG - Intergenic
959407130 3:105973789-105973811 TTGACATTCTTTGGCAAAACAGG + Intergenic
961001107 3:123374674-123374696 TTTGTCTTCTTTGGCAAAAGGGG + Intronic
961438680 3:126937562-126937584 AGGGTCTTCATTTGTAAAACAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962976295 3:140448956-140448978 TTGCTCTTCTTTGGTAAAACGGG + Intronic
965257358 3:166431429-166431451 CTTGTCTTCTTTGTCAAAACTGG - Intergenic
967139398 3:186541544-186541566 CAGCTCTTCATTGGCAAAACAGG + Intronic
972232771 4:37094621-37094643 TAAGTCTTCTTTGGCAAAGAGGG + Intergenic
972453435 4:39228256-39228278 AAGGTGTTCTTTGGGAAAACTGG + Exonic
973303947 4:48622447-48622469 TGATTCTGCTTTGGCAGAACTGG + Intronic
974565548 4:63575394-63575416 TAGGTCTTCTCTGGCCACACTGG + Intergenic
974886847 4:67829885-67829907 TGGGGCCTCTTTTGCAATACTGG + Intronic
977886442 4:102257468-102257490 AAGGCCTTCTTGGGCAAAACAGG + Intronic
979119277 4:116874399-116874421 TGGGTCTTCTATACCAATACAGG + Intergenic
980797970 4:137710615-137710637 TAGTTCTTCTTTGGAAATACGGG + Intergenic
981356538 4:143795919-143795941 TGGGTGTGATTTGGGAAAACTGG - Intergenic
981368072 4:143926513-143926535 TGGGTGTGATTTGGGAAAACTGG - Intergenic
981377865 4:144036791-144036813 TGGGTTTGATTTGGGAAAACTGG - Intergenic
982301843 4:153887049-153887071 TGGGTACTCTTTTGCAAAAAAGG + Intergenic
984891517 4:184498382-184498404 GGGGGCTTCTTTGGCCAAATTGG + Intergenic
986439665 5:7768831-7768853 TGGGGCTTCCTTGGCAACGCTGG - Intronic
987910908 5:24144071-24144093 TTGTTTTTCTTTGGTAAAACAGG + Intronic
988708369 5:33748083-33748105 TGGGTCATCTATGGCAGAAAAGG - Intronic
991395691 5:66202811-66202833 TGGGTCTTATTTAGGAAAAAAGG + Intergenic
998569223 5:143242450-143242472 TGGGTTTTCTTTGGCTAGAAAGG + Intergenic
999090323 5:148930524-148930546 AGTTTCTTCTTTGGTAAAACTGG + Intronic
1005214963 6:23515177-23515199 GGGGGCTTCTTTGTCAAAACTGG - Intergenic
1005991949 6:30908721-30908743 TGTCTCATCTTTGGCTAAACAGG - Intronic
1006224296 6:32522889-32522911 TGTGTCTGTTTGGGCAAAACGGG + Intronic
1008818652 6:55603630-55603652 AAGGTCTTCTTGGGGAAAACTGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1012665432 6:101962285-101962307 TGGTTCTTCTTTATGAAAACTGG + Intronic
1013366028 6:109439006-109439028 TGTGTCTGCTTTTGCAACACAGG + Intronic
1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015867199 6:137739504-137739526 AGGCTCTTCTTTGGCAGAAGGGG - Intergenic
1016121854 6:140353445-140353467 TGTAGCTACTTTGGCAAAACAGG + Intergenic
1016304856 6:142673162-142673184 TGGCTTTTCTCAGGCAAAACTGG - Intergenic
1018331192 6:162728490-162728512 TGGGTGGTCTTTGCCAAAAAAGG + Intronic
1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG + Intronic
1018953524 6:168393508-168393530 TGGGTCTCCCTTGGGAAAGCAGG + Intergenic
1023662398 7:42483307-42483329 TGGCTCTTCTATGGCAGAACTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030055474 7:105580632-105580654 TGGGTGTTTTTTGGCAAAATTGG + Intronic
1033040191 7:137910337-137910359 AGGGACCTCTTTGGCAAGACTGG - Intronic
1033785086 7:144720410-144720432 TGAATCTTATTAGGCAAAACAGG + Intronic
1034985607 7:155512200-155512222 TGGGTTTTCTCTGGCTACACAGG - Intronic
1035480577 7:159179286-159179308 TGGGTCTTCAGTGGCAACTCAGG + Intergenic
1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG + Intergenic
1036613513 8:10370746-10370768 TGGGGCATCTTTGACAAAGCAGG - Intronic
1037333862 8:17773112-17773134 TGGATCCTCTCTGGCATAACAGG - Intronic
1037453806 8:19043738-19043760 TGTGTCATCTGTGGCAAAAGGGG - Intronic
1037678519 8:21073276-21073298 TGGGTCTTCCTGGGCATACCGGG + Intergenic
1038995731 8:32920877-32920899 TGGGTTTTCAATGGCAAATCTGG - Intergenic
1039614649 8:38945717-38945739 TTGGTCTCCTCTGGCACAACTGG - Intronic
1040521532 8:48180472-48180494 TGGGTCTTACTTGGCTAAAATGG + Intergenic
1040719266 8:50297479-50297501 TGGGTTGTCTTTGGCATATCTGG + Intronic
1046530015 8:115432939-115432961 TGTGTATTCTTTGGTAAAAGTGG + Intronic
1048277819 8:133080521-133080543 TGAGTCTTATTTGGAAACACAGG - Intronic
1049122719 8:140753812-140753834 TGGGGATTTTTTGACAAAACAGG - Intronic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1049302186 8:141877388-141877410 TGGGTCACCTTTGCCAGAACCGG + Intergenic
1051789680 9:20786677-20786699 TAGTACTTCTTTGTCAAAACAGG - Intronic
1054755708 9:68955627-68955649 TGGCACTTCTTTGCCAAAACAGG + Intronic
1055992192 9:82118856-82118878 TGCATCTTCTTTGGCTAAACAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060806532 9:126581088-126581110 TGGGCTTTCTTTTGCAAAATGGG + Intergenic
1061442909 9:130618721-130618743 TGGGTCTTCTCTGGGAAGAATGG + Intronic
1061545081 9:131299742-131299764 AGGGTCTCCTATGGCCAAACGGG - Intronic
1062293632 9:135811322-135811344 TGGGCCTTCTTTGGCACTGCAGG + Exonic
1185476264 X:417328-417350 GGGCTCTTCTGTGGCAAAAGGGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193262114 X:79420244-79420266 TGGATAGTCCTTGGCAAAACAGG + Intergenic
1194086663 X:89536628-89536650 TGGACCTTCATTGGCCAAACTGG - Intergenic
1196151861 X:112383317-112383339 TGGGTCCTCTATGGGAAAATAGG + Intergenic
1199611803 X:149623945-149623967 TGTGTATTCTTTTGCAAATCAGG - Intronic
1200439322 Y:3192502-3192524 TGGACCTTCATTGGCCAAACTGG - Intergenic