ID: 1150223584

View in Genome Browser
Species Human (GRCh38)
Location 17:63510670-63510692
Sequence ATCCTCTGGGAAGAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150223584_1150223591 8 Left 1150223584 17:63510670-63510692 CCCTCACCCTCTTCCCAGAGGAT 0: 1
1: 0
2: 1
3: 42
4: 317
Right 1150223591 17:63510701-63510723 TTTCCTGATGCATATTGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150223584 Original CRISPR ATCCTCTGGGAAGAGGGTGA GGG (reversed) Intronic
901922523 1:12547330-12547352 ATCCCCTGGAGAGAGGGTGGAGG - Intergenic
903648267 1:24907548-24907570 AACCTCTGTGAAGAGGCTGGCGG - Intronic
903913966 1:26749593-26749615 ACCCTCTGGGTGGAGGCTGAGGG - Intronic
904403102 1:30269742-30269764 ATCCTCTGGGAATGGGGTGGGGG + Intergenic
904855244 1:33492982-33493004 AATCTCTTAGAAGAGGGTGAGGG + Intronic
905869432 1:41394706-41394728 CCCCTCTGGGGAGAGGGTGGTGG + Intergenic
906702042 1:47866651-47866673 ATGCGCTGGAATGAGGGTGAAGG + Intronic
908518298 1:64915900-64915922 AGCTGCAGGGAAGAGGGTGAAGG - Intronic
910413572 1:86972661-86972683 ATCCCCTGGGGATAGGGTGCTGG + Intronic
911045458 1:93624038-93624060 TGCCTCTAGGAAGAGGGAGAGGG + Intronic
912526556 1:110287714-110287736 CTCCTCTGGCAAGAGTGTAATGG + Intergenic
912581392 1:110724188-110724210 ATCCTTTGGGAAGATGGTGCTGG - Intergenic
913411670 1:118559058-118559080 CTTCTCTGGGCAGAGGATGATGG + Intergenic
915142557 1:153776408-153776430 CTGCTCTTGGATGAGGGTGAAGG - Intronic
915277070 1:154796392-154796414 CCCGTCTGGGAAGAGGTTGAGGG + Intronic
915603334 1:156936056-156936078 AGCCTGTGGGAGGAGGATGAAGG + Exonic
916269906 1:162929338-162929360 ATGCTGTGGGAACATGGTGATGG - Intergenic
916455131 1:164963143-164963165 ATCCTCTGGGTAAGGGGAGAGGG - Intergenic
917638647 1:176960892-176960914 AGCCTGAGGGTAGAGGGTGAAGG - Intronic
918249025 1:182685201-182685223 ATCCTGTGGCCAGAGGGTGGTGG + Intergenic
919897601 1:202018754-202018776 CTCCTGGGGGAAGTGGGTGAAGG + Intergenic
920179870 1:204126000-204126022 AGCCTCAGAGAGGAGGGTGAGGG + Exonic
921830105 1:219718544-219718566 ATCCTTTGGCTAGAGGGTGGAGG - Intronic
922046343 1:221949571-221949593 CTCATCTGGGAAGAGGGTAGAGG - Intergenic
922533383 1:226361764-226361786 ATCCTCTGGAAACTGGGGGAAGG + Intronic
923265260 1:232307545-232307567 TTCCTCTTGGAAGAGGGGAAGGG - Intergenic
923524267 1:234760141-234760163 AACCTCGGGAAGGAGGGTGAGGG - Intergenic
1064136503 10:12755205-12755227 AATCTCTGAGAAGTGGGTGAGGG + Intronic
1064581304 10:16795862-16795884 AGCCCCTGGGAAGAGGGTGCCGG - Intronic
1065104837 10:22372479-22372501 AGCCACTGGGAGGTGGGTGAGGG + Intronic
1067109440 10:43389829-43389851 AGCCTCTGGGAAGAGAGTCAAGG + Intronic
1067727118 10:48778764-48778786 GTCGTCTGGGCAGAGGCTGACGG - Exonic
1068757651 10:60672395-60672417 ATCCTCTGGGAAGAGGCAATGGG + Intronic
1072464492 10:95650613-95650635 CTGCTCTTGGAAGAGGATGAAGG - Intronic
1074219954 10:111426792-111426814 ATGCTGGGTGAAGAGGGTGAGGG - Intergenic
1074691858 10:116013177-116013199 ATTCTCTGGGTGGAGGGAGATGG - Intergenic
1075161116 10:120025398-120025420 ATGCTCAGAGAAGAGGGTGAGGG + Intergenic
1075231097 10:120679040-120679062 ATCTTATGGGCAGATGGTGATGG - Intergenic
1077647275 11:3936750-3936772 ATCCTTTGAGGAGAGGTTGAAGG + Intronic
1078170900 11:8928546-8928568 AGCCTGTGGGAGGAGGGTGGAGG - Intronic
1078893360 11:15577200-15577222 ATCCTCAAGGAAGAGGGTACAGG + Intergenic
1079329402 11:19521250-19521272 ACCCTCTGAGAGGAGGGTGAGGG + Intronic
1080262364 11:30363516-30363538 AGCGTCTGGAAAGTGGGTGAAGG + Intergenic
1080262442 11:30364222-30364244 AGCGTCTGGAAAGTGGGTGAAGG - Intergenic
1080357032 11:31461203-31461225 ATTCTCTTGGAAGAGGAAGATGG - Intronic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1082843085 11:57705140-57705162 ATTCTGTGGGAAGAAGGTGAAGG - Exonic
1083718501 11:64592452-64592474 AACCTCTGGGAGAGGGGTGAGGG + Intronic
1088008409 11:104969701-104969723 ATCCTCTGGGAAGAAGCTTCCGG + Intergenic
1088805212 11:113346124-113346146 ATCCTCAGAGAAGAGGTTGAAGG + Intronic
1091046130 11:132327543-132327565 ACCTTCTAGCAAGAGGGTGAGGG - Intronic
1091173577 11:133540221-133540243 CTCCCCTGGGAAGAGAATGAAGG - Intergenic
1092829390 12:12429237-12429259 ATCTTCTGAAAAGAGGGAGAAGG - Intronic
1096334114 12:50740078-50740100 ATCAACTGGGCAGAGGGTGATGG - Intronic
1096588768 12:52643584-52643606 AACCTCTGGGAACAGGAAGACGG + Intergenic
1097260234 12:57715760-57715782 TTCCTCTGTGACGAGGGTGCAGG + Exonic
1101572553 12:105967185-105967207 TGCCTCTGGGATGAGGGTGCTGG - Intergenic
1101625077 12:106432513-106432535 ATAGTCTGTGAAGAGGGGGAGGG + Intronic
1102665239 12:114566368-114566390 TTCCCCTGGGAAGATGCTGAGGG + Intergenic
1102688777 12:114744167-114744189 ATCCTGTGGGAAAAGGGGAAAGG + Intergenic
1103019448 12:117522269-117522291 AGCCTTTGAGAAGGGGGTGAGGG + Intronic
1103041735 12:117701446-117701468 ATGCTTTGGGAAGATGCTGAAGG - Intronic
1103337287 12:120199248-120199270 ATTCTCCAGGAAGAGGGAGACGG + Intronic
1103762780 12:123263668-123263690 AACCTTTGTGAAGAGGTTGACGG - Intronic
1104912820 12:132247837-132247859 AGCGTCTGGGAACAGGATGAGGG - Intronic
1105558184 13:21465589-21465611 ATGCTCTGGGAAGGGAGAGAAGG + Intergenic
1106120614 13:26857348-26857370 AAACAGTGGGAAGAGGGTGAGGG - Intergenic
1107924591 13:45246489-45246511 ATTCACTTGGAACAGGGTGATGG - Intronic
1111135738 13:84040337-84040359 ATCCTCAGGGAAGTGGGATACGG - Intergenic
1112106713 13:96248318-96248340 ACCCTCTGGGAAAAGGATGGGGG - Intronic
1113949741 13:114065379-114065401 AGCCTCGGGGTAGAGGGTAAAGG + Intronic
1114563917 14:23614331-23614353 ATCCTCAGGAAAGAAGGGGATGG + Intergenic
1115715185 14:36095547-36095569 TTCCTGGGAGAAGAGGGTGAGGG - Intergenic
1116783891 14:49267234-49267256 AACCTCTGGTAAGACAGTGAAGG + Intergenic
1118247822 14:64128820-64128842 CTCCCCTGGCAAGAGGATGAGGG - Intronic
1118292784 14:64541184-64541206 CTCCTCTGGGAAGAAGGTCTTGG - Exonic
1118445955 14:65851390-65851412 GTCCTCTGGGAAGAGAGTGCAGG - Intergenic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1119920304 14:78440335-78440357 TTCCTCAGGGAAGAAGGTGATGG - Intronic
1120669565 14:87348394-87348416 ATCCTTTTGGAAAAGGCTGAGGG + Intergenic
1121633751 14:95439877-95439899 CTTCTTTGGGAAGTGGGTGAGGG + Intronic
1122702383 14:103598565-103598587 ACCCTCTGGGAAGGGAGTGTGGG + Intronic
1122784069 14:104155851-104155873 GCCCTGTGGGAAGAGGGTGGAGG + Intronic
1123409119 15:20044024-20044046 ATGTCCTGGGAATAGGGTGAGGG - Intergenic
1123518450 15:21050732-21050754 ATGTCCTGGGAATAGGGTGAGGG - Intergenic
1125727479 15:41875435-41875457 GTCCACTGGGAAGAGGGACAGGG - Intronic
1126430873 15:48582934-48582956 CTCCTCTGGGAAGAGTCTCATGG + Intronic
1127856768 15:62960014-62960036 ATACTGTGGGGAGAGGGGGATGG + Intergenic
1129677589 15:77640744-77640766 TTCCTGGGGGAGGAGGGTGAAGG + Intronic
1129684584 15:77677821-77677843 ATGGTCTGGGAGGAGGGTGGAGG - Intronic
1129687670 15:77695809-77695831 ATGCTCTGGGGACAGGCTGATGG - Intronic
1130050382 15:80479252-80479274 AGCATCTGGGGTGAGGGTGATGG + Intronic
1130353315 15:83109390-83109412 AGCCACTGGGAAGATGGTGATGG + Intronic
1130485885 15:84398324-84398346 ATGTTCTTGGAAGAGGGTCACGG + Intergenic
1130990293 15:88871985-88872007 ATTGTCTGGGGAAAGGGTGAGGG - Exonic
1131137132 15:89945880-89945902 TTCCTCTGGGGAGAAGGAGATGG + Intergenic
1131149264 15:90036728-90036750 TTCCTGTGTGAAGAGGATGAGGG - Intronic
1131279082 15:91006395-91006417 ATCCTCTGACAAGAGCCTGAAGG - Exonic
1131530075 15:93183426-93183448 ATCCACAGGGATGAGTGTGATGG - Intergenic
1132250503 15:100332442-100332464 ATCCTCTGGGGAGCAGGTGGGGG - Intronic
1132322791 15:100938609-100938631 ATCATCTGGAAAGAGAGAGAAGG - Intronic
1132465081 16:73647-73669 TTCCTCTGGATAGAGGGTGCAGG + Intronic
1132584462 16:700288-700310 ATACTCTGGGGAGGGGGAGATGG - Intronic
1132626683 16:894728-894750 ACACGGTGGGAAGAGGGTGAGGG + Intronic
1132704476 16:1237175-1237197 CTCCTCTGGGAGGAGGGAGCTGG + Intergenic
1133077679 16:3292221-3292243 GTCCTTTGGGAACAGGCTGATGG + Intronic
1133712815 16:8417796-8417818 AACCTAGGGGAAGAGGGTGTTGG - Intergenic
1133896201 16:9931618-9931640 ATCCTTTGGTAAGAGGGTTTTGG + Intronic
1134138536 16:11696831-11696853 ACCCTCTGGGCAGAGGCTGTGGG + Intronic
1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG + Exonic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1137012312 16:35335247-35335269 TTCCCCTGTGAATAGGGTGAGGG + Intergenic
1138116088 16:54361830-54361852 ACGCTCAGGGGAGAGGGTGAGGG + Intergenic
1138323834 16:56143950-56143972 ATCTTCTGGCATGAGGTTGAAGG + Intergenic
1139420431 16:66846130-66846152 ATCCTCTGGGAGGCAGGTGGTGG + Intronic
1140786163 16:78344104-78344126 ATCCTAAGGGCAGAGGGTGAAGG + Intronic
1140964086 16:79947284-79947306 GCCTTCTGGGAAGATGGTGAGGG + Intergenic
1141339123 16:83186880-83186902 ATCCCCTGTGAAGGTGGTGAAGG + Intronic
1142020784 16:87780899-87780921 AGCCTGTGGGGAGAGGGTGAAGG - Intergenic
1142092604 16:88222884-88222906 ATCCTTTGGGATGAGTGTGGTGG - Intergenic
1142167742 16:88601827-88601849 GACCTCTGGGAACAGGGTCAGGG + Intronic
1142805645 17:2369837-2369859 AGACTCTGGGAAGAAGGGGAGGG - Intronic
1143172417 17:4937961-4937983 ATCCCCTGGGAAAGGTGTGAAGG - Intronic
1143439671 17:6959799-6959821 ATCATCTAGGAACAGGGAGAAGG + Intronic
1143683557 17:8495574-8495596 ATCCTCTGTGGGGAGGCTGAAGG + Intronic
1144379451 17:14679737-14679759 ACCCTCTGGGCAATGGGTGATGG - Intergenic
1145932720 17:28697600-28697622 TTCCTGTGGGAAGAAGGTAAAGG - Exonic
1146311055 17:31768589-31768611 ATCCTCAGGGAAGGTGGAGAAGG + Intergenic
1148868621 17:50642508-50642530 ACACTCAGGGAAGCGGGTGATGG - Intronic
1148894672 17:50832870-50832892 ACCCACAGGGAAGAGTGTGAGGG + Intergenic
1149478708 17:56984695-56984717 ATCTCCTGGGGAGAGGGTGATGG + Intronic
1149754930 17:59178713-59178735 CTCCCCTGAGAAGAGGCTGAAGG + Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1151539270 17:74756962-74756984 GACTTCTGGGAGGAGGGTGAGGG + Intronic
1151560836 17:74868772-74868794 ATCCTCAGGGAGGAGGGAGGGGG - Intronic
1151996937 17:77615627-77615649 TTTCTCTTGGAAGGGGGTGAAGG - Intergenic
1153181869 18:2444443-2444465 ATGCTATGGGAAGATGGTGAAGG + Intergenic
1153985951 18:10351015-10351037 CTCTCCTGGGAAGAGGATGAAGG + Intergenic
1153986108 18:10352266-10352288 GTCCTATGGGCAGTGGGTGAGGG + Intergenic
1157286025 18:46378009-46378031 GGCATTTGGGAAGAGGGTGAGGG + Intronic
1157473062 18:48004417-48004439 ATCATCTGGGGAGAGGGCAAAGG - Intergenic
1157511144 18:48275715-48275737 ATCTTCCAGGAAGAGGGTAAAGG + Intronic
1158851466 18:61499228-61499250 ATCCTCTCGGGAGAAGGTGCTGG + Exonic
1160419524 18:78734600-78734622 ATCATCTGAGAACAGGGTGGAGG + Intergenic
1160961066 19:1721038-1721060 GACCTTTGGGGAGAGGGTGAGGG - Intergenic
1160985590 19:1837172-1837194 ACCCTCTGGGAAGAGGGGTCTGG + Intronic
1162274266 19:9640453-9640475 TTCGTCTGGGAAGGGGGTAAAGG + Intronic
1162531238 19:11237553-11237575 ATCCACTGGGGAGAGGCTGGAGG + Exonic
1162550753 19:11357087-11357109 ACCGGCTGGGAAGAGGGGGAAGG + Intronic
1164699899 19:30277898-30277920 GCCCTCTGGGAGGAGGGTGGTGG + Intronic
1164704629 19:30311192-30311214 ATGCTCTGGGCAGAGGTGGAGGG + Intronic
1165144484 19:33722612-33722634 AGCCCCAGGGAAGAGGGGGAAGG - Intronic
1165783012 19:38444662-38444684 TCCCGCTGCGAAGAGGGTGAGGG + Exonic
1166747950 19:45150904-45150926 ATACCCTGGGATGAGGCTGAGGG - Exonic
1166881136 19:45930817-45930839 CTCCTCTGGGCAGGGGGTGAGGG - Intergenic
1166976373 19:46607372-46607394 ACCCTCTGGGAATAGGCTGCCGG + Intronic
1166978843 19:46621103-46621125 TGGCTCTGGGAAGAGAGTGAGGG - Exonic
1167240182 19:48338873-48338895 AGCCTCTGAGCTGAGGGTGAGGG + Intronic
925404891 2:3599672-3599694 ATCCTGAGGGCAGTGGGTGAGGG - Intronic
926229245 2:10990354-10990376 ATCTCCTGGGCAGGGGGTGAAGG + Intergenic
926816279 2:16800964-16800986 TTTCTCTGGGTATAGGGTGAGGG - Intergenic
927518986 2:23688036-23688058 ATGCTCAGGGAAGAGGGTGAAGG - Intronic
927913698 2:26920113-26920135 ATCTTCAGGGAAGAGAGGGATGG + Intronic
927954653 2:27200137-27200159 ATCCTCTGGGAAAAAGATAATGG - Exonic
928323500 2:30302209-30302231 ATCTCCTGGGAGGAGGGTGTGGG + Intronic
929022233 2:37565069-37565091 ATATTCTGGAAAGAGAGTGATGG - Intergenic
929570185 2:43018059-43018081 ATTCTTTGAGATGAGGGTGAAGG + Intergenic
931306278 2:61031951-61031973 GACCTCTGGGCAGAGAGTGAAGG + Exonic
933269546 2:80218278-80218300 ATCTTATGGGAAGAGGCTGAGGG + Intronic
934136520 2:89001036-89001058 ATCCTGTGGGAACTGGGTTAGGG + Intergenic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
937301954 2:120848051-120848073 AAGCTGTGGGAAGAGGGAGAAGG + Intronic
938558774 2:132451054-132451076 ATGCTCTGGGAAGAGGTAGAGGG + Intronic
939869552 2:147511633-147511655 ATCCCCTGGGAGGAGGAGGAAGG - Intergenic
942510037 2:176688309-176688331 ATCATCTGAGCAGAGGGAGATGG + Intergenic
942609791 2:177731548-177731570 ATCGTCAGTGCAGAGGGTGAGGG - Intronic
944198756 2:197083324-197083346 TTCCTCTGGGAACAGGGTTGGGG - Intronic
946505755 2:220299029-220299051 AAACTCTGGCAAGAGCGTGAAGG + Intergenic
946511821 2:220366277-220366299 ATCATCTGGGAGTAGGGTGGAGG - Intergenic
947033352 2:225823324-225823346 ATCCTCTGGGAAGAAGGCTCAGG - Intergenic
948836521 2:240628680-240628702 CTCCTCTGGGCAGAGGGAGGAGG + Intronic
1168793503 20:595954-595976 TGCCTCTGGGAGGAGAGTGAGGG + Intergenic
1169341281 20:4798258-4798280 ATCCTGGGGGAAGATGGTTATGG - Intronic
1170593972 20:17791866-17791888 ATACTCTGGGCAGAGGTTGCAGG - Intergenic
1171221133 20:23399031-23399053 TTCCTCTGGGGAGAGGGAGTTGG - Intronic
1172520391 20:35562068-35562090 ATCCTGGGGGATGAGGATGAAGG + Intergenic
1173752712 20:45489497-45489519 ATCCTTTGGGGTGAGGGAGAAGG + Intergenic
1173850048 20:46212041-46212063 ATCCTCTGGAAAGGAGCTGAAGG + Intronic
1173950055 20:46985159-46985181 ATCTTGTTGGAAGAAGGTGATGG + Intronic
1175531262 20:59675203-59675225 ATTAGCTGGGAAGAGGGAGAAGG - Intronic
1175594981 20:60223863-60223885 ACCCCCTGGGAAGGCGGTGAGGG - Intergenic
1176554031 21:8245318-8245340 ATCCCCTGGGGAGGGGGTGGGGG - Intergenic
1176572953 21:8428342-8428364 ATCCCCTGGGGAGGGGGTGGGGG - Intergenic
1178271967 21:31199217-31199239 ATCGTCAGGCAAGAGCGTGACGG - Intronic
1178440294 21:32593068-32593090 ATCCTCTGGGAAGAAGGACAGGG - Intronic
1181500613 22:23313652-23313674 CTCCTCTGGGGAGGGGGTGGTGG + Intronic
1181545473 22:23599795-23599817 ACCCTCTGTGAAGACGATGAGGG - Intergenic
1181685675 22:24526153-24526175 CACCAGTGGGAAGAGGGTGAGGG + Exonic
1181754394 22:25013033-25013055 ATCCTCTGGGTAGAGTGGGATGG + Intronic
1183314708 22:37130441-37130463 ATCCCCTGGGAAGTGGGGGTGGG + Intronic
1184068328 22:42132870-42132892 ATGATCTGGGAAGAGGCAGATGG + Intergenic
1184097345 22:42323693-42323715 TGCCTCTGGGAAGAAGGTGTGGG - Intronic
1184528087 22:45037245-45037267 ATCCCCTAGGGAGAGGGTGTAGG - Intergenic
1184567286 22:45299584-45299606 ATCCTGTGGGATGAGGATGCAGG + Intergenic
1203259036 22_KI270733v1_random:162356-162378 ATCCCCTGGGGAGGGGGTGGGGG - Intergenic
949221506 3:1639450-1639472 AGCCTCTTGGCAGAAGGTGAAGG - Intergenic
949531013 3:4955153-4955175 AAAAGCTGGGAAGAGGGTGAGGG - Intergenic
950089657 3:10286703-10286725 ATCCTCTGGGAAGAGGCCAAAGG - Exonic
950440437 3:13007226-13007248 AACCCCTAGGAAGAGGGTCAGGG + Intronic
950602879 3:14050362-14050384 ATCCTCTGAGCTGTGGGTGATGG - Intronic
951616401 3:24550710-24550732 GTGCTTTTGGAAGAGGGTGAAGG - Intergenic
951622987 3:24626358-24626380 ACTCTCTGGGAAGATGATGAGGG + Intergenic
951770952 3:26257255-26257277 ATCCTCTTGAAAGAGAGTTATGG + Intergenic
952305409 3:32141741-32141763 TCCCTCTGGGAAGAGGGAAATGG - Intronic
952754338 3:36852955-36852977 AACCTGGGGGAAAAGGGTGATGG - Intronic
953476099 3:43207125-43207147 ATTCTCTGAGAAGAGGATTAAGG - Intergenic
954414154 3:50384809-50384831 TTCCTCTGGGACCAGGGAGAGGG + Intronic
955343792 3:58146017-58146039 ATCCTCTGTGACGATGGTGAAGG - Exonic
955473995 3:59316447-59316469 ACTCTCTAGGAAGAGGGTGTTGG - Intergenic
956323166 3:68021471-68021493 ATCCTATGATAAAAGGGTGATGG - Intronic
957782240 3:84834520-84834542 ATCATCTGGGATGATGGTGGAGG + Intergenic
958850537 3:99319558-99319580 ATCTTCTAGGAAGAGGAAGAAGG - Intergenic
959160835 3:102722632-102722654 ATCCACTGGGAAGATGATGAGGG - Intergenic
960914786 3:122684086-122684108 ACCCTCTGTGAAGAGGGTGGAGG - Intronic
962063015 3:131951526-131951548 AGACTGTGGGGAGAGGGTGAAGG - Intronic
962293884 3:134162454-134162476 ATGCTCTGGGAGGAGGGGGCAGG + Intronic
962350669 3:134653431-134653453 AACCTCTGAGAAGAGGGTCTAGG - Intronic
963113471 3:141705946-141705968 AAAGGCTGGGAAGAGGGTGAGGG + Intergenic
963966316 3:151374850-151374872 ATCATCTGGTAAGAGGGATATGG - Intronic
964330456 3:155596238-155596260 ACCCTCTAGGAAGAGTGAGAAGG - Exonic
964745762 3:160011061-160011083 CTCCTCTGGGAGAAGGGAGATGG - Intergenic
966636140 3:182135954-182135976 ATTCTCTGGGAAGGGAGAGAGGG - Intergenic
966904138 3:184509416-184509438 ATCGTCTGGGTGGAGGGTGGAGG - Intronic
967222164 3:187256566-187256588 ATCCTGGGAGAAGAAGGTGAAGG + Intronic
967222241 3:187257114-187257136 ATCCTCTGGTATGGGGGTCAGGG + Intronic
967930777 3:194688363-194688385 CCCCTCTGGGATGCGGGTGAGGG + Exonic
967951121 3:194841523-194841545 TTCCTCAGGGAAGTGGGTGATGG + Intergenic
968501260 4:951309-951331 ACCCTCAGGGAAGAGGGGAAGGG + Intronic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
970874202 4:20850496-20850518 CTCCTCTGGGAATTGTGTGAAGG + Intronic
975611738 4:76210587-76210609 ATCCCCTAGGAAGAGGGTGTGGG + Intronic
975838626 4:78451142-78451164 AATCTCTGGGAAGAGGGGGCTGG - Intronic
975844199 4:78507736-78507758 GTCCTCTGGAAAGGGGATGATGG - Intronic
976467173 4:85383882-85383904 ACCCTCTGGGAAGAGTGAGAAGG - Intergenic
978429105 4:108614829-108614851 ATCATATTGGAGGAGGGTGATGG - Intergenic
978734188 4:112066562-112066584 ATCAGCTGGGAAGTGGGTGTTGG + Intergenic
980743642 4:136986132-136986154 ATCATATGGGATGAGGGTGAGGG - Intergenic
980955086 4:139419765-139419787 TTCCTCTGGGAAGAGGAAGAAGG + Intronic
981604034 4:146522877-146522899 AAACTCTGGGAAGAGGGTCGCGG + Intergenic
981927674 4:150157403-150157425 ATACTCAGAGAAGAGGGTGGTGG - Intronic
982890475 4:160843082-160843104 ACCATCTGGGAAGAGTCTGATGG + Intergenic
985565397 5:612711-612733 ATCCGCTGAGAAGAGGGAGCCGG + Intronic
985862139 5:2479532-2479554 ATCCTCGGGGAAGAATGAGAGGG + Intergenic
985955379 5:3261851-3261873 ACCCTCTGGGAAGTGGATGAGGG - Intergenic
987123734 5:14792067-14792089 ATCCTTTGGGACGAGGGTGGAGG + Intronic
988821580 5:34891479-34891501 ATCTTCTGTGAAGAAGGGGAAGG - Intronic
989458793 5:41672329-41672351 AGCATCTGGGAAGAGGAGGAGGG + Intergenic
989680568 5:44023696-44023718 ATCATATGGGGAGAGAGTGAGGG - Intergenic
990497805 5:56366443-56366465 ATCCTCTGGGGACAGGATGCTGG - Intergenic
992077035 5:73201668-73201690 ATTCTCTCTGAAGAGGGTGCAGG - Intergenic
992944860 5:81800065-81800087 CTCCTTTGGGATGAGGATGAAGG - Intergenic
996680752 5:126226274-126226296 ATCCTCAGGGAAGGGCGAGAAGG + Intergenic
997481042 5:134184745-134184767 GTCCTCTGGGCAGAGGGGTAGGG - Intronic
997528534 5:134568552-134568574 CTCCTCTGGGAAGAGGAAGCAGG + Intronic
998256892 5:140594845-140594867 AGCCTCTTGGAAGAGGGGGAGGG - Intergenic
998583701 5:143404520-143404542 AGACTCGGGGAAGAGGGTGGGGG - Intronic
998673637 5:144382253-144382275 AGCATGTGGGAAGAGGGTGAAGG + Intronic
1000174135 5:158733971-158733993 AACATCTGGGAAGTGGGGGATGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003334774 6:5160165-5160187 ATCCACTGGGAAGAAGGGAATGG - Intronic
1003540544 6:7014627-7014649 AGCCACTGGGCTGAGGGTGAGGG - Intergenic
1004144382 6:13051388-13051410 ATCCTCTGAGCAGAGGGACAAGG - Intronic
1004890741 6:20098040-20098062 AACCACTGGGAAGAAGGTTATGG + Intergenic
1006993154 6:38232892-38232914 ATCCTCTGGGAAGGGCTTGTTGG - Intronic
1007763187 6:44146154-44146176 GTCTTCTGGGAACAGGGTTAAGG + Intronic
1007881745 6:45175923-45175945 AATCTTTGGGAAGAAGGTGAAGG + Intronic
1008722896 6:54378885-54378907 ATCCTTTGGCATGAGAGTGAGGG - Intronic
1009385436 6:63080673-63080695 ATCCTCAGGGAAGGGTGAGAAGG - Intergenic
1012751114 6:103165151-103165173 ATACTCTGGGTAGATGGGGAAGG - Intergenic
1014625793 6:123722720-123722742 ATGCTCTTGGGAGAGAGTGAAGG - Intergenic
1016700488 6:147048653-147048675 ATCCACTGTGCAGAGGCTGATGG - Intergenic
1017646083 6:156541151-156541173 ACTCTCTGGGGTGAGGGTGAAGG - Intergenic
1019998846 7:4743077-4743099 ACCCTCTGGGATGATGATGATGG + Intronic
1021398965 7:20187485-20187507 AAGCTGTGGGAAGAGGGAGAAGG - Intronic
1022691649 7:32662186-32662208 AGCATCTGGGAAGAGGCTGCGGG - Intergenic
1023311405 7:38890636-38890658 ACCCTTTGGAAAGCGGGTGAAGG + Intronic
1026443500 7:70464017-70464039 ATCCTTTGGGAAGAGGCTGGTGG - Intronic
1027749489 7:82124319-82124341 CTGCCCTGGGAAGAGGGTGGAGG - Intronic
1028106923 7:86889373-86889395 ATCCCCTGGGAATAGGGTGGGGG - Intronic
1028461771 7:91102183-91102205 TTGCTCTGTGAAGAGTGTGACGG + Intronic
1028912829 7:96227702-96227724 ATCCTTGGGGAAGAGGGCCAGGG + Intronic
1029202658 7:98849392-98849414 ACCCTCATGGCAGAGGGTGAGGG - Intronic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1029756675 7:102578209-102578231 AGCCACAGGGAAGAGGGAGAGGG + Intronic
1033832669 7:145272331-145272353 ATCTTCAGGGAAGAGGGAGGAGG + Intergenic
1034292703 7:149945529-149945551 AGGCTCTGGGGACAGGGTGAAGG + Intergenic
1034352041 7:150422591-150422613 ATCATCTGGGGTGTGGGTGAGGG + Intergenic
1034462332 7:151204832-151204854 AAGCTCTGGGGAGAGGGTGGCGG + Exonic
1034813361 7:154151343-154151365 AGGCTCTGGGGACAGGGTGAAGG - Intronic
1035423860 7:158753817-158753839 AGCCCCTGGGAAGTGTGTGAAGG - Intronic
1035763169 8:2084982-2085004 ATTCTGTTGGAAGAGGGGGAAGG - Intronic
1035994862 8:4534412-4534434 ATACTCTGGCAAGAGAGTAAAGG - Intronic
1036185933 8:6622364-6622386 ATCCCCGGAGAAGAGGGTTAAGG + Intronic
1036937405 8:13016753-13016775 GTCCTCTGGGGAAAGGGGGAAGG - Intronic
1038747757 8:30269026-30269048 ATCCACGGTGAGGAGGGTGATGG + Intergenic
1039692657 8:39879370-39879392 ATCCTCAGGGAAGATTGAGAAGG - Intergenic
1040505586 8:48045048-48045070 ATCCACTGGGATGGGGGTGAAGG + Intronic
1041610417 8:59840213-59840235 AACCTCATGGAAGAGGATGATGG + Intergenic
1041987591 8:63943745-63943767 TTTCTCGGGGAAGAGGGAGAGGG + Intergenic
1042563799 8:70093291-70093313 AACCACTGGCAAGAGGGTGCTGG + Intergenic
1043607413 8:82019070-82019092 AACTCCTGGGAAGAGGGTGGTGG + Intergenic
1044857314 8:96489981-96490003 CTTCTCTGGGAAGGGGTTGATGG + Intergenic
1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG + Intronic
1047933002 8:129749407-129749429 AAGTTCAGGGAAGAGGGTGAGGG - Intronic
1048037579 8:130692481-130692503 GTACTCTGGGGAGAGGGAGATGG + Intergenic
1048260991 8:132944901-132944923 TCCCTGTGGGAAGAGGGTGCAGG + Intronic
1048263830 8:132967860-132967882 TGCCTCTGGGTAGAGGGTGCAGG - Exonic
1048450309 8:134527699-134527721 ATCCTGTGGGAAGAGGGGCTGGG - Intronic
1049355338 8:142184968-142184990 TTGCTGTGGGCAGAGGGTGAGGG - Intergenic
1050484702 9:6121877-6121899 ATTCTTTGGGAAGTGGATGACGG - Intergenic
1051359014 9:16265531-16265553 GTTCTCAGGGGAGAGGGTGATGG - Intronic
1055270099 9:74548165-74548187 ACCGTGTGGGGAGAGGGTGAGGG + Intronic
1055463254 9:76539162-76539184 ATCCTCTGGGAAGGGGGAGGGGG - Intergenic
1056299371 9:85226092-85226114 AGCCTCAGGGAGTAGGGTGAGGG - Intergenic
1056663462 9:88561711-88561733 ATCCTCTGGGCAGAGGTTCTCGG - Intronic
1057876625 9:98760341-98760363 AACCTCTGGGGAGAGGGAGAGGG - Intronic
1058067433 9:100565012-100565034 ATGCATTGGGAAGAGGGAGAAGG + Intronic
1058232029 9:102437469-102437491 ATACTTTGGGAAAAGAGTGATGG + Intergenic
1058808099 9:108612288-108612310 AGCCTCTGGGAAGATGATGCTGG - Intergenic
1058970848 9:110081631-110081653 AGCCTTTGGGAAGCGGGTGCTGG - Intronic
1059093665 9:111389315-111389337 GTCCACTGGGAAGATGGTTAAGG - Intronic
1059407400 9:114109752-114109774 ATCCTCTGGGGTGGGGGTGGCGG - Intergenic
1059634979 9:116161412-116161434 AACTTCTGGGACAAGGGTGAAGG + Intronic
1060822070 9:126667099-126667121 CGCCTCTGGGAAAGGGGTGAGGG - Intronic
1061037672 9:128122544-128122566 CTCCTCTGGGGAGAGGGGGGAGG + Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1062194569 9:135265740-135265762 ATCCTCCGGGAACAGGGAGAAGG + Intergenic
1062345836 9:136114757-136114779 AGCCTCTTGGCTGAGGGTGAAGG - Exonic
1203475227 Un_GL000220v1:144365-144387 ATCCCCTGGGGAGGGGGTGGGGG - Intergenic
1185695979 X:2194983-2195005 ATCCTTTAGAAAGAGGGTGCTGG + Intergenic
1185914826 X:4024280-4024302 ATCCTCTGTGATGAGGGTCTGGG + Intergenic
1185945454 X:4370664-4370686 ATTTTCTGGAAAGAGGATGATGG + Intergenic
1186171605 X:6882935-6882957 ATCCTGTGGACAGAGGGTGTTGG + Intergenic
1186253459 X:7694244-7694266 ATCCTCTGTGAAGTGGGCAAGGG + Intergenic
1187522875 X:20028975-20028997 TTCCACGGGGAGGAGGGTGAGGG - Intronic
1190082169 X:47365189-47365211 ACACTTTGGGAAGAGGGTGCAGG - Intergenic
1193195905 X:78631501-78631523 ATCCTCTGAGAATTGGGTGGAGG - Intergenic
1194499860 X:94668609-94668631 TTCCTCAGGGAAGAGGGTTCAGG - Intergenic
1195707523 X:107748748-107748770 ATCCTCTGGAAAGCCTGTGAAGG - Intronic
1197125285 X:122938806-122938828 AACCTCATGGAAGAGGATGAAGG + Intergenic
1198307853 X:135400423-135400445 ATCCTCTGAGGAGAGGCTGGTGG - Intergenic
1198370365 X:135983807-135983829 GTCTTCTGGGGAGAGGATGATGG + Intergenic
1198596428 X:138240930-138240952 ATCCTATGGGGAGAGGGAGAAGG - Intergenic
1199034201 X:143032098-143032120 GTCTTCTGGGGAGAGGGTGGAGG + Intronic
1200072821 X:153537442-153537464 AGTCTCTGGGTTGAGGGTGAGGG - Intronic
1201077978 Y:10200772-10200794 GTCCACTGGGGAGAGGGTGGGGG + Intergenic
1201160273 Y:11160197-11160219 ATTCTCAGGGAAGAGGATGCCGG - Intergenic
1201407082 Y:13660325-13660347 ATCCTCAGGGAAGGTGGAGAAGG - Intergenic
1201496125 Y:14592988-14593010 ATCCTCTGGGAAGGTTGAGAAGG - Intronic
1201907819 Y:19103439-19103461 ATCCTCAGGGAAGGTGGAGAAGG - Intergenic
1201911481 Y:19137559-19137581 ATCCTCAGGGAAGGTGGAGAAGG + Intergenic