ID: 1150225605

View in Genome Browser
Species Human (GRCh38)
Location 17:63523102-63523124
Sequence AGAAGCCGCGCGCCGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150225605_1150225609 -10 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225609 17:63523115-63523137 CGCGGCTTCTTTCAGCACCAAGG No data
1150225605_1150225611 6 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225611 17:63523131-63523153 ACCAAGGCGTGGACAGCTCCCGG No data
1150225605_1150225614 11 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225614 17:63523136-63523158 GGCGTGGACAGCTCCCGGGCCGG No data
1150225605_1150225610 -5 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225610 17:63523120-63523142 CTTCTTTCAGCACCAAGGCGTGG No data
1150225605_1150225615 19 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225615 17:63523144-63523166 CAGCTCCCGGGCCGGCGCAGAGG No data
1150225605_1150225617 24 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225617 17:63523149-63523171 CCCGGGCCGGCGCAGAGGAGAGG No data
1150225605_1150225613 7 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225613 17:63523132-63523154 CCAAGGCGTGGACAGCTCCCGGG No data
1150225605_1150225619 27 Left 1150225605 17:63523102-63523124 CCCGCCGCCGGCGCGCGGCTTCT No data
Right 1150225619 17:63523152-63523174 GGGCCGGCGCAGAGGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150225605 Original CRISPR AGAAGCCGCGCGCCGGCGGC GGG (reversed) Intergenic