ID: 1150225606

View in Genome Browser
Species Human (GRCh38)
Location 17:63523103-63523125
Sequence AAGAAGCCGCGCGCCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150225606_1150225613 6 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225613 17:63523132-63523154 CCAAGGCGTGGACAGCTCCCGGG No data
1150225606_1150225619 26 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225619 17:63523152-63523174 GGGCCGGCGCAGAGGAGAGGAGG No data
1150225606_1150225614 10 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225614 17:63523136-63523158 GGCGTGGACAGCTCCCGGGCCGG No data
1150225606_1150225610 -6 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225610 17:63523120-63523142 CTTCTTTCAGCACCAAGGCGTGG No data
1150225606_1150225611 5 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225611 17:63523131-63523153 ACCAAGGCGTGGACAGCTCCCGG No data
1150225606_1150225615 18 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225615 17:63523144-63523166 CAGCTCCCGGGCCGGCGCAGAGG No data
1150225606_1150225617 23 Left 1150225606 17:63523103-63523125 CCGCCGCCGGCGCGCGGCTTCTT No data
Right 1150225617 17:63523149-63523171 CCCGGGCCGGCGCAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150225606 Original CRISPR AAGAAGCCGCGCGCCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr