ID: 1150226124

View in Genome Browser
Species Human (GRCh38)
Location 17:63525387-63525409
Sequence CTGTAAACACAAAGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 294}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150226124_1150226132 -4 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226132 17:63525406-63525428 ACAGGCAGGATTTCTGGGGAAGG 0: 1
1: 0
2: 3
3: 47
4: 369
1150226124_1150226137 24 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226137 17:63525434-63525456 CTCAGGGGAGAGAAGTCCCCAGG 0: 1
1: 0
2: 1
3: 27
4: 189
1150226124_1150226135 8 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226135 17:63525418-63525440 TCTGGGGAAGGAGGTGCTCAGGG 0: 1
1: 0
2: 4
3: 42
4: 536
1150226124_1150226129 -10 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226129 17:63525400-63525422 GTGTTTACAGGCAGGATTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 178
1150226124_1150226139 29 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226139 17:63525439-63525461 GGGAGAGAAGTCCCCAGGGAAGG 0: 1
1: 0
2: 4
3: 62
4: 470
1150226124_1150226138 25 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226138 17:63525435-63525457 TCAGGGGAGAGAAGTCCCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 246
1150226124_1150226133 -1 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226133 17:63525409-63525431 GGCAGGATTTCTGGGGAAGGAGG 0: 1
1: 0
2: 5
3: 52
4: 496
1150226124_1150226130 -9 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226130 17:63525401-63525423 TGTTTACAGGCAGGATTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 236
1150226124_1150226131 -8 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226131 17:63525402-63525424 GTTTACAGGCAGGATTTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 203
1150226124_1150226134 7 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226134 17:63525417-63525439 TTCTGGGGAAGGAGGTGCTCAGG 0: 1
1: 0
2: 4
3: 33
4: 370
1150226124_1150226136 9 Left 1150226124 17:63525387-63525409 CCCAGCTGCCTTTGTGTTTACAG 0: 1
1: 0
2: 2
3: 16
4: 294
Right 1150226136 17:63525419-63525441 CTGGGGAAGGAGGTGCTCAGGGG 0: 1
1: 1
2: 9
3: 68
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150226124 Original CRISPR CTGTAAACACAAAGGCAGCT GGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900810273 1:4796462-4796484 CTTTTAAAACCAAGGCAGCTGGG + Intergenic
901881240 1:12194997-12195019 CTGTAAACACAATGGAGGCAAGG - Intronic
902242422 1:15097916-15097938 TTTTTAACACAAAGGCAGCATGG - Intronic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
906342232 1:44990537-44990559 CTATAAATACAAAATCAGCTGGG - Intergenic
906560974 1:46756598-46756620 GTGTAAAGACAATGCCAGCTTGG + Intergenic
907975449 1:59427169-59427191 CTCTAGCCACAAAGACAGCTGGG + Intronic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
908610606 1:65855962-65855984 CTGTAAACAAAAAGAAAACTGGG - Intronic
909804171 1:79854228-79854250 CAGTAACCCCAAGGGCAGCTTGG + Intergenic
910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG + Intergenic
910190444 1:84589514-84589536 CTGGAAAAACCCAGGCAGCTAGG + Intergenic
910356396 1:86361956-86361978 CATCAAACACAAAAGCAGCTAGG + Intronic
913156690 1:116106650-116106672 CTGAAAACACAAAATTAGCTGGG - Intergenic
913546246 1:119871693-119871715 TTGTAGAAAGAAAGGCAGCTAGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917998963 1:180472493-180472515 CTACAAACACAAAGGCAGGCTGG + Intronic
918365780 1:183806286-183806308 TTGTAAGCAGCAAGGCAGCTGGG + Intronic
921255106 1:213331871-213331893 ATGTCAAAACAAAGGCAGCCTGG - Intergenic
921532201 1:216298480-216298502 CTTTAAACATTAAGGCAGCCAGG - Intronic
922009505 1:221567749-221567771 TTGTTAACACACAGGCAGATAGG + Intergenic
923031772 1:230254890-230254912 CTGTAAATATAAAGGCCTCTTGG - Intronic
1063320800 10:5051390-5051412 CATAAAACACAAAGTCAGCTGGG - Intronic
1063377108 10:5561085-5561107 CTGTAAACACATAGGATGCAGGG - Intergenic
1063732883 10:8719799-8719821 CTTCAAAGACAAAGGCTGCTAGG + Intergenic
1065255707 10:23865592-23865614 CTATAAAAAAAAAGGCAGTTTGG - Intronic
1065888340 10:30098520-30098542 CTGTAAACTCCAAGAAAGCTGGG + Intronic
1066641074 10:37554778-37554800 CTGTAAACACAAATTCACCCTGG - Intergenic
1067548495 10:47215050-47215072 AAGCAAACTCAAAGGCAGCTGGG + Intergenic
1068603604 10:58981104-58981126 CTGTAAATAAAAAAGCTGCTTGG + Intergenic
1070531862 10:77343918-77343940 CTATGAAGACAAAGGCAGCCTGG + Intronic
1070769965 10:79076495-79076517 CTGTAAAGACACATGCTGCTGGG - Intronic
1070961087 10:80500714-80500736 CAGTAAACACAGAGTCAGCCAGG + Intronic
1071144396 10:82550584-82550606 CTAAAAACACAAAGGAATCTTGG - Intronic
1071914068 10:90270905-90270927 AAGTAAACACAAAAGCAGCTTGG - Intergenic
1075224639 10:120616556-120616578 CTTTAAATATAAAGGCAGATAGG + Intergenic
1076891934 10:133289072-133289094 CTGTGTAGACAAAGACAGCTGGG - Intronic
1076891946 10:133289146-133289168 CTGTGTAGACAAAGACAGCTGGG - Intronic
1078465483 11:11547001-11547023 TTTCAAACACAAAGGCAGCTTGG + Intronic
1079362709 11:19782627-19782649 CTGGAAAGACAATGGCAGCCTGG - Intronic
1079781435 11:24610782-24610804 CTGAAAACACAAAATGAGCTGGG + Intronic
1080589098 11:33705887-33705909 CTGTAAACCTATAGCCAGCTTGG + Intronic
1081201068 11:40215756-40215778 GTGCAAACACAAAGGCAGTCTGG + Intronic
1081518320 11:43856027-43856049 ATGCAGAAACAAAGGCAGCTGGG - Exonic
1081976925 11:47241354-47241376 CTGAAAATACAAAATCAGCTGGG + Intronic
1083919684 11:65775595-65775617 CTGTAAGCACCCAGGAAGCTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085013912 11:73159948-73159970 CTGAATTAACAAAGGCAGCTGGG - Intergenic
1086524188 11:87705284-87705306 CTATAATAACAAAAGCAGCTTGG - Intergenic
1086607698 11:88716137-88716159 CTGTAAGGTCAAGGGCAGCTTGG + Intronic
1087047965 11:93859550-93859572 CTTTAAACACACACGCATCTTGG - Intergenic
1088672735 11:112159189-112159211 CTGAAAACACAAAATTAGCTGGG + Intronic
1089082150 11:115785456-115785478 GTGTACACACAAATACAGCTGGG - Intergenic
1089097232 11:115929335-115929357 CTGCAAAGACAAAGACAGCTAGG - Intergenic
1090593610 11:128297039-128297061 CGGTGAGCTCAAAGGCAGCTGGG - Intergenic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1093269639 12:17044435-17044457 CCTGAAATACAAAGGCAGCTGGG - Intergenic
1094085068 12:26581391-26581413 CTTTAAAAACAAAGTCAGGTAGG - Intronic
1094312848 12:29104437-29104459 CTGAAAACACAAAAGAACCTTGG - Intergenic
1095818653 12:46452634-46452656 ATGGAAACATAAAGGCAGTTAGG - Intergenic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1096781226 12:53993384-53993406 CTGAAGACTCAAAGGCTGCTAGG - Intronic
1097623628 12:61972731-61972753 CTGGAAACACTAAGTCATCTGGG + Intronic
1098181708 12:67854162-67854184 ATGGAAAAATAAAGGCAGCTTGG - Intergenic
1100644166 12:96511477-96511499 CTAAAAACACAAAAGTAGCTGGG - Intronic
1102290397 12:111694506-111694528 CTCTAAAAAAAAAGGCAGCAGGG + Intronic
1103103927 12:118205980-118206002 CTGTAACCACAAAGAAGGCTTGG - Intronic
1103870888 12:124090786-124090808 CTATAAAAACAAAGGAAGCCTGG + Intronic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1105412764 13:20185025-20185047 CTGTGAACACTGGGGCAGCTGGG + Intergenic
1105761763 13:23521829-23521851 GTGGAAAAGCAAAGGCAGCTTGG - Intergenic
1106088384 13:26563063-26563085 CTGGAGACACAATGGCACCTAGG - Intronic
1106752000 13:32782440-32782462 CTGAAAACAAAATAGCAGCTGGG - Intergenic
1107928210 13:45284652-45284674 CTGCAAACACTATGGCAACTTGG - Exonic
1109112670 13:58342955-58342977 CTGTAACCAAAAAGGTAACTTGG + Intergenic
1111298490 13:86315857-86315879 CTAAAAATACAAAGTCAGCTGGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1113643060 13:111972013-111972035 GTGTAAACAAAAAGGCAGACAGG - Intergenic
1114278580 14:21169660-21169682 CTTCAATCACAAAGGCAGCCCGG + Intergenic
1116767797 14:49093136-49093158 CTATAAACATATAGGCATCTTGG - Intergenic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1120526422 14:85581978-85582000 CTGTAAACATGAATGCAGTTTGG + Intronic
1120616578 14:86713324-86713346 CTGAAAACAGAAAGTCAACTTGG - Intergenic
1121191087 14:92030759-92030781 GTGTGTACACAAAGGCAACTGGG + Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123020283 14:105394718-105394740 ATGTTAACAGAAATGCAGCTGGG - Exonic
1123198978 14:106643437-106643459 CTGCAAACACAAAGACACCAAGG + Intergenic
1123808973 15:23904487-23904509 TTGCAAACAATAAGGCAGCTGGG + Intergenic
1126425615 15:48524222-48524244 CTTAGAACACAAAGGGAGCTCGG + Intronic
1126638213 15:50800174-50800196 CTGTGATCACAATTGCAGCTAGG - Intergenic
1127364645 15:58276559-58276581 CTAAAAACACAAAAGTAGCTGGG - Intronic
1127726940 15:61759605-61759627 TTGTAACCACACATGCAGCTGGG - Intergenic
1133613049 16:7451028-7451050 TGGTAAACTCAGAGGCAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135675355 16:24410660-24410682 CTAAAAACACAAAGTTAGCTGGG + Intergenic
1138178313 16:54924006-54924028 ATCTAAACACATAGGCAGATTGG - Intergenic
1139848857 16:69938905-69938927 CTGAGAACACAAAGCCAGGTTGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141445426 16:84054977-84054999 CTCTAAACACAAGGGAAGATGGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1144056484 17:11546548-11546570 GTGCAAACAAAAAGGAAGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146995029 17:37312729-37312751 CTGAAATAATAAAGGCAGCTGGG + Intronic
1148518785 17:48248638-48248660 CTGTAATCACATAGGCTCCTTGG - Intronic
1148653625 17:49267403-49267425 CTGAAAATACAAAGTTAGCTGGG + Intergenic
1148820734 17:50358184-50358206 CTGTAGAGAGAGAGGCAGCTGGG - Intronic
1149294345 17:55248257-55248279 ATGCAAACACAATGGCAGCAGGG + Intergenic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1154136181 18:11780654-11780676 GTGAAAACCCAAAGGCAGATTGG - Intronic
1154144156 18:11852224-11852246 CTGTAAACCCAAAGGTAGAAGGG - Exonic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155736851 18:29235060-29235082 CTTTAAAAACAAAGTCTGCTGGG + Intergenic
1156507336 18:37606310-37606332 TTGCAAACACAATGGCACCTTGG - Intergenic
1156684579 18:39629188-39629210 CTGTAAGAACAAAGGAATCTGGG - Intergenic
1158333771 18:56392176-56392198 CAGCTAACAAAAAGGCAGCTTGG + Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1160513953 18:79468300-79468322 CTGTACCCACAAAGGAAGCCGGG - Intronic
1163524147 19:17810193-17810215 CTGAAAACACAAAAGTGGCTAGG + Intronic
1166079999 19:40437990-40438012 CTGAAAATACAAAATCAGCTGGG + Intergenic
1166490067 19:43251284-43251306 GTGTAAACACAATGACAGGTTGG - Intronic
1167880733 19:52455358-52455380 CTAAAAACACAAAAGTAGCTGGG - Intronic
1167933391 19:52886772-52886794 CTAAAAACACAAAGTGAGCTGGG + Intronic
1168271258 19:55250974-55250996 CTGAAAACAGAAGGCCAGCTTGG - Intronic
1168610747 19:57797666-57797688 CTGAAAATACAAAATCAGCTGGG + Intronic
927396497 2:22656920-22656942 CTAAAAACACAAAAGTAGCTGGG + Intergenic
927628168 2:24746029-24746051 ATTTAAAAAGAAAGGCAGCTAGG - Intronic
927803191 2:26120508-26120530 CTGCTAAAACAAAGGCAACTTGG - Intronic
928298369 2:30105044-30105066 CTAAAAACACAAAATCAGCTGGG - Intergenic
930461525 2:51684239-51684261 CTGTAATGACAAGGGAAGCTGGG + Intergenic
931653082 2:64486190-64486212 CAGTAAACACAAAGGTTGCCTGG + Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
932974693 2:76585021-76585043 CTAAAAACACAAAATCAGCTGGG - Intergenic
933290496 2:80433233-80433255 CTGTAAACACCATGCCAGCCAGG + Intronic
934756061 2:96825531-96825553 CTGCAAAAACAAAAGCACCTAGG - Intronic
937016003 2:118606343-118606365 CTCAAAACACAAAGGTAGCCAGG - Intergenic
938469653 2:131546756-131546778 CTAAAAACACAAAGTTAGCTGGG - Intergenic
940551061 2:155157467-155157489 ATGTATTCACAAAGGGAGCTGGG - Intergenic
940982826 2:160022636-160022658 CTTTTAAACCAAAGGCAGCTGGG + Intronic
941481102 2:166014501-166014523 TTGTAAGCACAAAGGCACTTAGG + Intronic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941826439 2:169902768-169902790 CTAAAAACACAAAGTTAGCTGGG - Intronic
944564900 2:200980007-200980029 CATTAAACACAAAGGCAGTGTGG + Exonic
945229706 2:207573397-207573419 CTCTAAAAACAAAAGCATCTGGG - Intronic
945457182 2:210063761-210063783 CTGTAAAATCAAAAGCAGGTTGG - Intronic
946065764 2:216985946-216985968 CTGACAAGACAAAGGCAGCCTGG - Intergenic
946872153 2:224093701-224093723 CTGTAATCACAAAGAAAACTAGG + Intergenic
948006084 2:234608803-234608825 CTGTAAACTCAAAAGCCTCTAGG + Intergenic
948794391 2:240394779-240394801 CTGTGAAGACAAAGGCAGATGGG - Intergenic
1169298073 20:4417062-4417084 CTAAAAACACAAAAGTAGCTGGG + Intergenic
1170143466 20:13148251-13148273 CTGTTAAAACAAAACCAGCTGGG - Intronic
1170498779 20:16953130-16953152 TTGTAATCTCAAAGGAAGCTTGG - Intergenic
1170695913 20:18658628-18658650 ATGTAAACACACAGGTAACTTGG + Intronic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1172240174 20:33407964-33407986 CTGTGAGCACACAGGCAGCCCGG - Exonic
1174408366 20:50317764-50317786 CAGTAACCACTTAGGCAGCTGGG + Intergenic
1174465770 20:50716118-50716140 CTTTAAACTTAAAGGCACCTGGG + Intergenic
1174590258 20:51639567-51639589 CTATGAACACAAAGGCAGAAGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175326592 20:58133464-58133486 CGATAAAAATAAAGGCAGCTTGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178428780 21:32500972-32500994 CTGAAAATACAAAGTTAGCTGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179050109 21:37881853-37881875 CTGTAGACAAAAGGACAGCTGGG + Intronic
1180222368 21:46367181-46367203 GTGGAAACACACAGGCAGCGAGG - Intronic
1180653799 22:17401840-17401862 CTGTTAAAAAAAAGGCAGCGGGG - Intronic
1180675735 22:17585093-17585115 CAGTAAAAAAAAAAGCAGCTGGG + Intronic
1180698584 22:17769700-17769722 CTCCACACACAGAGGCAGCTGGG + Intronic
1181181513 22:21071779-21071801 GTGTAAAGACAATGCCAGCTTGG + Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181747516 22:24966182-24966204 CTATCAACACAAAGTCAGCTGGG - Intronic
1181750209 22:24983937-24983959 CTAAAAACACAAAGTTAGCTGGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182670482 22:31991378-31991400 ATGAAAAGACAAAGGCAGCCAGG + Intergenic
1183960813 22:41410938-41410960 CTCTAAACACAAAGGAGGCCAGG - Intergenic
1184716390 22:46284581-46284603 CAGAAAAGAAAAAGGCAGCTGGG + Intronic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
949529254 3:4937953-4937975 CTGTAAAACCAAAGAAAGCTTGG + Intergenic
950028083 3:9834365-9834387 GTGTAAACACTAAAGGAGCTGGG - Intronic
950894006 3:16431628-16431650 CTTTAAACACTAAGGCCACTCGG + Intronic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
952455934 3:33471915-33471937 CTGAAAACACAAAATCAGCCGGG - Intergenic
953912019 3:46898090-46898112 CTGTGACCGCAATGGCAGCTGGG + Exonic
954033799 3:47839453-47839475 CTAAAAACACAAAATCAGCTGGG - Intronic
954142926 3:48619669-48619691 CCATAGAAACAAAGGCAGCTAGG + Intergenic
955087344 3:55716093-55716115 CTGTCAACACAAAGTCAGCTTGG - Intronic
959559569 3:107764151-107764173 CTGGAAACACAAAATTAGCTGGG - Intronic
959632365 3:108521801-108521823 CTGTGAACAAAAAGCCAGCCAGG - Intronic
959712712 3:109401014-109401036 CTAAAAACACAAAGTTAGCTGGG - Intergenic
960564314 3:119117756-119117778 CTGTAAAATCAAAGGCAAGTTGG + Intronic
961640101 3:128359875-128359897 CTGTGAGCACGGAGGCAGCTGGG - Intronic
964719966 3:159761608-159761630 CTGGAAACAGAAAGGAAACTGGG + Intronic
966012530 3:175098486-175098508 CTGTGCACACAAGGGCAGATAGG + Intronic
966378879 3:179323509-179323531 CCGTAAAGACAACGGCAGCAGGG - Intronic
966606957 3:181831241-181831263 CTCTAAACAGAAAGGAAGGTTGG - Intergenic
967084513 3:186081816-186081838 TTGTAAGCACAAAGGTAGCCAGG - Intronic
971561442 4:28083886-28083908 CTATAAAAACAAAAGCAACTTGG + Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972778359 4:42264411-42264433 ATGTTAACTCCAAGGCAGCTGGG + Intergenic
973967653 4:56180326-56180348 CTAAAAACACAAAAACAGCTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974386593 4:61207955-61207977 CTGTAAAAAGATAGGCAGGTTGG + Intronic
975782126 4:77850304-77850326 CTGAAAATACAAAAACAGCTGGG + Intergenic
976525176 4:86078826-86078848 CTAAAAATACAAAAGCAGCTGGG + Intronic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
984186242 4:176547054-176547076 CTTTAAACTACAAGGCAGCTGGG - Intergenic
984312497 4:178080451-178080473 CTGTAAACATGAAGGTAACTAGG - Intergenic
984923129 4:184783303-184783325 GTATAAGCACAAAGGAAGCTGGG - Intronic
985723619 5:1503831-1503853 CTGTTATCTTAAAGGCAGCTGGG - Intronic
986108796 5:4689496-4689518 CTGAAAATACAAAATCAGCTGGG + Intergenic
986112101 5:4729717-4729739 CAGTACACACCAAGGCAGCATGG - Intergenic
986248113 5:6029433-6029455 CTGGAAGAGCAAAGGCAGCTGGG + Intergenic
986528766 5:8711430-8711452 CTATAAGCAGAAGGGCAGCTGGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991690452 5:69220358-69220380 AAGTAAAGACAAAGCCAGCTGGG + Intronic
992963090 5:81974774-81974796 CTTAAAACTCAAAGGAAGCTTGG - Intronic
993694416 5:91043442-91043464 CTCTGAACAAAAAGGCTGCTGGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG + Intronic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
996857197 5:128021966-128021988 CTGTAAACAGAAAGACAGATTGG + Intergenic
997440519 5:133905815-133905837 CTCTAGCCACAAGGGCAGCTGGG - Intergenic
998122622 5:139591279-139591301 CTAAAAACACAAAGTTAGCTGGG - Intronic
998245800 5:140503726-140503748 CTAAAAACACAAAGTTAGCTGGG - Intronic
999432125 5:151533453-151533475 CAGTCAACACAAAGGCAGGGTGG - Intronic
999505121 5:152186511-152186533 CTGAAAAAACAAAGGCATTTTGG + Intergenic
999859350 5:155628745-155628767 CTAAAAATACAAAGTCAGCTGGG + Intergenic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1000850569 5:166335151-166335173 CTGAAAACACTGAGGTAGCTGGG - Intergenic
1001051488 5:168417908-168417930 CTGCAGACACAAAGACAGCTGGG - Intronic
1001114162 5:168924806-168924828 CTCAAAACTCAAATGCAGCTGGG - Intronic
1001545519 5:172568433-172568455 CTCAAGACACAAAGGCAACTCGG - Intergenic
1002145690 5:177179374-177179396 CTAAAAACACAAAATCAGCTGGG - Intronic
1002325444 5:178402109-178402131 GTTAAAAGACAAAGGCAGCTGGG - Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1003216806 6:4120895-4120917 ATGTTAACAAAAAGGCAGTTAGG + Intronic
1003235424 6:4291140-4291162 CTTAAAACACAAACACAGCTAGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006371837 6:33649573-33649595 CTGTAACCACAATGACATCTTGG + Intronic
1007944580 6:45814103-45814125 CTGTAAACACAAAGCAAATTAGG + Intergenic
1010139389 6:72596916-72596938 GTGTAATCACCAAGGCAACTGGG + Intergenic
1010996566 6:82540403-82540425 CTGAAAATACAAAACCAGCTGGG - Intergenic
1011605373 6:89099694-89099716 CTGAAAATACAAAGTTAGCTGGG - Intronic
1012542388 6:100376352-100376374 AAGTAAACACAGAGGCACCTTGG + Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013502306 6:110765011-110765033 CTGTAAACCCAAGGTCATCTAGG - Intronic
1017513373 6:155133876-155133898 CTAAAAACACAAAATCAGCTGGG - Intronic
1019493123 7:1324314-1324336 CTGAAAAAACAAAGACAGGTGGG - Intergenic
1022297590 7:29070575-29070597 TTGTAAACACAAAGGAAGAGGGG - Intronic
1026010182 7:66629678-66629700 CTGGAAAAACAAAGGCATTTTGG + Intronic
1026185017 7:68075641-68075663 CTAAAAACACAAAGTTAGCTGGG - Intergenic
1026216113 7:68350593-68350615 CTGAAAATACAAAATCAGCTGGG + Intergenic
1028520747 7:91727906-91727928 CTGCAAACACAAAGGCAAACTGG - Intronic
1029090604 7:98045143-98045165 CTCTGCACACAAGGGCAGCTGGG + Intergenic
1030866842 7:114710565-114710587 CTGCCCACACAAAGGCAGGTGGG - Intergenic
1030925414 7:115447529-115447551 TTATAAACCCAAAGGAAGCTAGG - Intergenic
1033067533 7:138170503-138170525 TTCCAAACACAAAGGCAGCAGGG + Intergenic
1033091060 7:138386389-138386411 CTGAAAACACAAAATTAGCTGGG - Intergenic
1034704880 7:153132314-153132336 CTATAAAAAAAAAGGCAGCTAGG + Intergenic
1034878070 7:154742807-154742829 TCCTAAACACCAAGGCAGCTGGG - Intronic
1037565474 8:20114407-20114429 ATGTAAACACGATGGCAGGTTGG - Intergenic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1041077579 8:54183266-54183288 CTATAAATAAAAAAGCAGCTGGG - Intergenic
1041109622 8:54472261-54472283 CTAAAAACACAAAGTCAGCTGGG + Intergenic
1041770900 8:61471687-61471709 CTGTAACCACAAAGCCCTCTTGG - Intronic
1044017540 8:87062574-87062596 CTGAAAATACAAAATCAGCTGGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044990423 8:97790738-97790760 CTCAAAACACAAAACCAGCTGGG - Intronic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1047194810 8:122712031-122712053 CTGAAAATACAAAGTTAGCTGGG - Intergenic
1048021599 8:130544665-130544687 CTGTCATCACCAAGCCAGCTTGG - Intergenic
1050352577 9:4754396-4754418 CTAAAAACACAAAAGTAGCTGGG + Intergenic
1051762281 9:20480873-20480895 CTACAAACACAAAGATAGCTAGG + Intronic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1052907015 9:33844363-33844385 CTGAAAATACAAAATCAGCTGGG - Intronic
1053390383 9:37730930-37730952 CTGCAAGGACAAAGGCAGTTAGG + Intronic
1054944105 9:70776301-70776323 CTGTAAAGTCGAAGGAAGCTGGG + Intronic
1054949936 9:70838523-70838545 CTGAAAAGACTAAGACAGCTGGG + Intronic
1056130185 9:83577188-83577210 CTGGAAAAAAAAAGTCAGCTGGG - Intergenic
1057507517 9:95648055-95648077 CTGTGAACACCAGGGTAGCTGGG + Intergenic
1057891474 9:98873257-98873279 CTCAAAAAAAAAAGGCAGCTTGG - Intergenic
1058831447 9:108820921-108820943 CCTTAAATATAAAGGCAGCTAGG + Intergenic
1059422961 9:114204403-114204425 CTGAAAGCACACAGTCAGCTTGG + Intronic
1059532814 9:115052740-115052762 CTGTAATGACAAAGGCAGTGAGG + Intronic
1059843547 9:118245628-118245650 CTATGAAGACACAGGCAGCTTGG - Intergenic
1061148221 9:128812998-128813020 CTTAAAACACAAATACAGCTGGG - Intergenic
1061561743 9:131408878-131408900 CTGAAAACACAAAATTAGCTGGG - Intronic
1061806889 9:133141758-133141780 CGGTAAACACACAGGCAGAGGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1189329369 X:40133985-40134007 CAATAAGCACAAAGGCATCTGGG + Intronic
1189919000 X:45885147-45885169 CTGTAAACATAAAGCAGGCTGGG + Intergenic
1190546034 X:51528348-51528370 CTAAAAACACAAAGTTAGCTGGG + Intergenic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1191894625 X:65979028-65979050 CTGTAAACAAAAGGGCAGGATGG - Intergenic
1192170667 X:68852595-68852617 CTGAACAAACAAAAGCAGCTGGG - Intergenic
1192179991 X:68910456-68910478 CAGGAACCTCAAAGGCAGCTAGG - Intergenic
1192236202 X:69297688-69297710 ATGTCACCAGAAAGGCAGCTTGG + Intergenic
1194267454 X:91772376-91772398 GTGAAACCACAAAGGCAGTTTGG - Intergenic
1195130221 X:101843815-101843837 CTGTAGACAGGAGGGCAGCTTGG - Intronic
1196425505 X:115564514-115564536 CTGAAAATAAAAGGGCAGCTTGG + Intronic
1198412340 X:136383523-136383545 CTTTAAATATAAAGACAGCTAGG - Intronic
1200012513 X:153129413-153129435 CTGGAAACACAAACACAGATAGG + Intergenic
1200027086 X:153270506-153270528 CTGGAAACACAAACACAGATAGG - Intergenic
1200584660 Y:4993314-4993336 GTGAAACCACAAAGGCAGTTTGG - Intergenic