ID: 1150228314

View in Genome Browser
Species Human (GRCh38)
Location 17:63535695-63535717
Sequence GACAGCGCGGCTGCTGCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 199}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150228299_1150228314 30 Left 1150228299 17:63535642-63535664 CCTGTGACCATTTCCCTACCCCT 0: 1
1: 0
2: 2
3: 21
4: 240
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228303_1150228314 12 Left 1150228303 17:63535660-63535682 CCCCTCCAGACCACAACCCTGAT 0: 1
1: 0
2: 1
3: 24
4: 299
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228308_1150228314 7 Left 1150228308 17:63535665-63535687 CCAGACCACAACCCTGATTGGGC 0: 1
1: 0
2: 1
3: 10
4: 82
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228310_1150228314 -4 Left 1150228310 17:63535676-63535698 CCCTGATTGGGCTATTGAAGACA 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228305_1150228314 10 Left 1150228305 17:63535662-63535684 CCTCCAGACCACAACCCTGATTG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228300_1150228314 23 Left 1150228300 17:63535649-63535671 CCATTTCCCTACCCCTCCAGACC 0: 1
1: 0
2: 4
3: 58
4: 612
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228311_1150228314 -5 Left 1150228311 17:63535677-63535699 CCTGATTGGGCTATTGAAGACAG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228301_1150228314 17 Left 1150228301 17:63535655-63535677 CCCTACCCCTCCAGACCACAACC 0: 1
1: 2
2: 0
3: 24
4: 270
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228309_1150228314 2 Left 1150228309 17:63535670-63535692 CCACAACCCTGATTGGGCTATTG 0: 1
1: 0
2: 3
3: 8
4: 94
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228304_1150228314 11 Left 1150228304 17:63535661-63535683 CCCTCCAGACCACAACCCTGATT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199
1150228302_1150228314 16 Left 1150228302 17:63535656-63535678 CCTACCCCTCCAGACCACAACCC 0: 1
1: 0
2: 0
3: 32
4: 433
Right 1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG 0: 1
1: 1
2: 1
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150228314 Original CRISPR GACAGCGCGGCTGCTGCGGC TGG Exonic
900126768 1:1072220-1072242 CACAGCGCGGGGGCTCCGGCGGG + Exonic
903283504 1:22263455-22263477 GACTGCACGGCTGCTGGGGTAGG - Intergenic
903337374 1:22634234-22634256 GACATGCCGGCTGCTGCAGCGGG + Intergenic
903597058 1:24502942-24502964 GGCGGCGAGGCTGCTGCTGCAGG + Exonic
903875146 1:26468960-26468982 GACAGAGCAGCTGCTGCGAGAGG + Exonic
904424192 1:30413088-30413110 GACCGCGAGCCTGCTGTGGCAGG + Intergenic
904424368 1:30414092-30414114 GACCGCGAGCCTGCTGTGGCAGG + Intergenic
905215009 1:36400785-36400807 GATAGGCCGGCTGCTGCAGCGGG + Intergenic
905584344 1:39105335-39105357 CCCGGCGCGGCTGCAGCGGCGGG - Intronic
907867822 1:58415801-58415823 GACAGTCTGGCTGCTGAGGCAGG - Intronic
915278946 1:154809239-154809261 GAAAGCGTGGCTGCTGGTGCTGG - Intronic
917345156 1:174022047-174022069 GGGAGCGGGGCTGCCGCGGCCGG - Intronic
919826478 1:201506964-201506986 GACAGCCCCGGGGCTGCGGCGGG + Intronic
920555358 1:206900315-206900337 GAGTGCCCGGCTGCTGCAGCAGG + Exonic
920850247 1:209623597-209623619 GGCAGAGAGGCTGGTGCGGCAGG - Exonic
921238342 1:213152352-213152374 GACGGGGCGGCTGATGGGGCGGG + Intronic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
923929995 1:238684543-238684565 GACAGCTGGGCTGCTGAGTCTGG - Intergenic
924539836 1:244970585-244970607 GGCAGGGCGACTGCTGCTGCCGG - Exonic
1062937417 10:1398824-1398846 GGCTGCGCTGCTGCTGCGGAGGG - Intronic
1063429542 10:5977182-5977204 GAGAGCGCCGCCGCTGCGCCCGG - Intronic
1063776698 10:9273218-9273240 GACGGGGCGGCTGCCCCGGCGGG + Intergenic
1063968249 10:11363394-11363416 GAGAGCGCGGATGCTGGCGCAGG + Intergenic
1068646217 10:59470837-59470859 CTCAGCGAGGCTGCTGTGGCCGG + Intergenic
1068969783 10:62948188-62948210 GACAGGGCGGCTGGCCCGGCTGG - Intergenic
1069761799 10:70816228-70816250 GGCGGCGGGGCGGCTGCGGCCGG + Intronic
1073106632 10:101036113-101036135 GACAGTGCAGCTGCTGCTGGGGG - Intronic
1075275308 10:121087415-121087437 GCCAGCCCTGCTGCTGGGGCTGG + Intergenic
1075438282 10:122461026-122461048 GACCGCGGGGCCTCTGCGGCCGG - Intergenic
1076628063 10:131834058-131834080 GACAGGGCAGCTGGTGCAGCGGG - Intergenic
1076814811 10:132909515-132909537 GACATGGTGGCTGCTGGGGCAGG + Intronic
1077518738 11:3018494-3018516 CACAGCACGGCAGTTGCGGCTGG - Exonic
1077833074 11:5897021-5897043 GACAGATCGGATGCTGGGGCAGG + Intronic
1078345133 11:10541145-10541167 GGCAGCGCAGCCGCTGCCGCAGG - Exonic
1078469729 11:11577346-11577368 GACAGCAGGGCTGCTCCAGCTGG - Intronic
1079102065 11:17547923-17547945 CACAGAACGGGTGCTGCGGCTGG - Intronic
1083753700 11:64778083-64778105 GAGGGGGCGGCTGCGGCGGCGGG + Exonic
1083888691 11:65585189-65585211 GACCGCGCAGCCGCTGCGCCAGG - Exonic
1084547057 11:69819728-69819750 GACAGCGCCACTGCTCCTGCAGG - Intergenic
1085100726 11:73797625-73797647 GACATGCCGGCTGCTGCAGCAGG - Intronic
1085561096 11:77473665-77473687 GGCAGCGCGGCGGCGGCGGCAGG - Exonic
1085622321 11:78046574-78046596 GTCAGCGCGGGGGCTGAGGCTGG + Intronic
1086092893 11:83021530-83021552 GACATCCCAGCTGCTGCTGCCGG - Intronic
1087385267 11:97462044-97462066 CCCTGCGAGGCTGCTGCGGCTGG - Intergenic
1088815131 11:113415448-113415470 GAAAGCTCGGCTGCTGCGTTTGG + Exonic
1090076331 11:123582107-123582129 GACTGTGGGGCTGCTGGGGCCGG + Intronic
1094041099 12:26122568-26122590 AGCAGCGCGGCCGCGGCGGCAGG + Exonic
1095837464 12:46654301-46654323 GAGAGGGAGGCTGCTGCAGCTGG - Intergenic
1095953333 12:47793446-47793468 GACAGTGAGGCAGGTGCGGCTGG + Exonic
1096691605 12:53325263-53325285 GACCGCGAGGCTGCGGCGGGCGG + Intergenic
1102351934 12:112199079-112199101 CACAGCAGGGCTCCTGCGGCCGG - Intronic
1103045418 12:117731342-117731364 GACAGGGCGGCTGCTGGGCGGGG - Intronic
1104376520 12:128268347-128268369 GGCCGCGCGGATGCGGCGGCGGG + Intronic
1105239680 13:18598393-18598415 GTCAGCGCCGCAGCTGCAGCAGG - Intergenic
1108787339 13:53921081-53921103 GACAGAACGGCTGCTGCCGTGGG + Intergenic
1110495199 13:76160259-76160281 GCCAGCTCTGCTGCTGCTGCTGG + Intergenic
1113570027 13:111346931-111346953 CACAGAGCGGCTGCAGCAGCAGG - Intergenic
1114066351 14:19062378-19062400 GACCACGCCGCTGCTGCTGCAGG - Intergenic
1114095917 14:19337646-19337668 GACCACGCCGCTGCTGCTGCAGG + Intergenic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1119722015 14:76898108-76898130 GACAGGGCGGCTGGCGGGGCGGG + Intergenic
1119743269 14:77027615-77027637 GACAGCGCGCCAGCTGAAGCGGG - Exonic
1119835758 14:77747717-77747739 GACGGGGCGGCTGCCGGGGCGGG - Intronic
1122102477 14:99424434-99424456 GAGAGCCAGGCTGCTGGGGCTGG + Intronic
1122338089 14:101007056-101007078 GACAGCCCTGCTCCTGCAGCAGG + Intergenic
1122789132 14:104176993-104177015 GTCAGCCCGGCTGCTGGGTCTGG - Exonic
1122874343 14:104656641-104656663 GACAGCGCGGGAGCGGGGGCGGG + Intergenic
1122878473 14:104679430-104679452 CACAGAGTGGCTGCTGCGGCTGG - Intergenic
1122923271 14:104888637-104888659 GACAGCTCAGCTGCCTCGGCGGG - Intronic
1125300545 15:38250627-38250649 GACAATGCTGCTGCTGAGGCAGG + Intergenic
1129373028 15:75109817-75109839 GGCAGCTCTGCTGCTGCTGCTGG - Intronic
1130025549 15:80267800-80267822 GAAAGCCCGGCTCCTGGGGCAGG - Intergenic
1130090086 15:80813640-80813662 GACAGTACTGCTGCTCCGGCCGG - Intronic
1132598724 16:764634-764656 GACAGCGCAGCTGCAGGGGCAGG - Exonic
1132805519 16:1773413-1773435 GGCGTTGCGGCTGCTGCGGCCGG + Exonic
1132867789 16:2102482-2102504 GACAGAGGGGCTGCTGCCCCTGG - Exonic
1132934201 16:2472761-2472783 GACACCCCCGCTGCGGCGGCCGG - Exonic
1134523989 16:14930632-14930654 GACAGAGGGGCTGCTGCCCCTGG + Intronic
1134548914 16:15130303-15130325 GACAGAGGGGCTGCTGCCCCTGG - Intronic
1134711582 16:16329117-16329139 GACAGAGGGGCTGCTGCCCCTGG + Intergenic
1134719433 16:16372416-16372438 GACAGAGGGGCTGCTGCCCCTGG + Intergenic
1134947993 16:18339469-18339491 GACAGAGGGGCTGCTGCCCCTGG - Intergenic
1134955247 16:18379576-18379598 GACAGAGGGGCTGCTGCCCCTGG - Intergenic
1135691120 16:24538970-24538992 GACAACGTGGCTGCTGAGCCTGG + Intronic
1139754766 16:69133091-69133113 GACAGTGAGGCTGATGGGGCAGG - Intronic
1140927613 16:79599271-79599293 GGCAGCGCGGCCGCCTCGGCCGG - Exonic
1142251575 16:88994241-88994263 GAGAGCACGGATGCTGAGGCAGG + Intergenic
1142285910 16:89171474-89171496 GACAGCGCAGGTGCGCCGGCGGG - Intergenic
1142336161 16:89490570-89490592 GACCCAGCGGCGGCTGCGGCGGG + Intergenic
1144447566 17:15344967-15344989 GACAGCGCTGCTGCTGAGATGGG + Intergenic
1144775681 17:17783483-17783505 GGCAGAGCGCCTGCTGCTGCCGG - Intronic
1145059024 17:19720767-19720789 CTCAGCGAGGCTGCTGGGGCTGG - Intergenic
1146262067 17:31428253-31428275 CACAGCGTGGCAGCTGCAGCAGG - Intronic
1147671544 17:42179833-42179855 GACAGCTCGGGTTCTGCTGCTGG - Intronic
1147791453 17:43016450-43016472 GACAGCTCTGCAGCTGCTGCAGG - Exonic
1149658940 17:58324536-58324558 GGCAGCGCGGCAGGGGCGGCCGG + Intronic
1150060682 17:62065694-62065716 GACATCGCCGCTGCCGCGCCGGG - Intergenic
1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG + Exonic
1152637414 17:81435787-81435809 GAAGGCAGGGCTGCTGCGGCCGG - Intronic
1152721898 17:81927505-81927527 GTGAGTGCGGCTGCGGCGGCGGG - Intronic
1154990213 18:21592577-21592599 GACGGGGCGGCTGGTGGGGCGGG + Intronic
1157610482 18:48952102-48952124 GGCGGCGCGGCTGCGGCGGCTGG - Intergenic
1160831254 19:1105826-1105848 GACAGTACGGCTGCTGGGGTGGG + Intronic
1160855850 19:1217488-1217510 GACAGGGCGGCAGCTGCAGAGGG + Intronic
1161359409 19:3838861-3838883 GACAGCTGGGCAGCTGCAGCTGG - Intronic
1161781926 19:6298577-6298599 GACACACCGGCTGCTGCAGCAGG - Intergenic
1162558447 19:11402087-11402109 GACAGCGCCTCTGCAGCTGCTGG + Exonic
1162560757 19:11416975-11416997 GGCAGCGCGCCTGGAGCGGCTGG - Exonic
1163287114 19:16355764-16355786 GCTGGCGCGGCTGCGGCGGCAGG - Exonic
1163587917 19:18173871-18173893 GCCACCGCTGCTGCTGCTGCTGG + Exonic
1166567525 19:43774320-43774342 GAGAGCGCCGATGCTGCGGTAGG + Exonic
1167504322 19:49863108-49863130 GACAGCGAGGCCCATGCGGCTGG - Intronic
1168272838 19:55259154-55259176 GCAAGCGCGTCTGCGGCGGCGGG - Intergenic
925928338 2:8685881-8685903 GGCAGCGCGGCTGGCGCCGCGGG - Intergenic
927808040 2:26165528-26165550 GACAGCTGGGCTACTGCGCCAGG - Intergenic
932568503 2:72924388-72924410 GCCCTCGCAGCTGCTGCGGCTGG + Exonic
932780679 2:74556626-74556648 GACAGCACGTCTGCTCAGGCAGG + Exonic
934751862 2:96798956-96798978 CACAGCGTGGCTGCTGTGGTTGG + Intronic
934892994 2:98087086-98087108 CACAGCGCGGCTCCTGGAGCCGG - Intergenic
934933171 2:98445001-98445023 GGCGGCGCTGCTGCTGCTGCGGG + Exonic
934933184 2:98445046-98445068 GACAGCGGGGCGGCTGGCGCCGG + Exonic
935686575 2:105689062-105689084 GAGAGCGGGGGTGCTGGGGCTGG - Intergenic
937512308 2:122609879-122609901 GACAGCAGAGCTGCTGCTGCCGG + Intergenic
938483745 2:131682514-131682536 GACCACGCTGCTGCTGCTGCAGG - Intergenic
938839351 2:135144056-135144078 GACAGAGCACCTCCTGCGGCAGG - Intronic
941793204 2:169575114-169575136 GACAGGGCGGCTGGCGGGGCGGG + Intergenic
942914873 2:181293789-181293811 CACATCGCTGCTGCTGCGGTTGG - Intergenic
943736883 2:191366033-191366055 GACACTGCTGCTGCTGCTGCTGG + Intronic
948231552 2:236352468-236352490 GATAGGGTGGCTGCTGCTGCAGG + Intronic
948361774 2:237426682-237426704 AACAGCTGGGCTGCTGCAGCTGG - Intergenic
948492140 2:238320557-238320579 GACCGGGCGGCGGCGGCGGCGGG + Exonic
948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG + Intergenic
1168889619 20:1286389-1286411 GACAGCAGGGCAGCTGCAGCTGG + Intronic
1169118773 20:3083288-3083310 GACACCGGGGCTGCGGCTGCAGG + Intronic
1172408132 20:34704329-34704351 GTCTGTGCGGCCGCTGCGGCGGG - Exonic
1173912993 20:46684101-46684123 GACAGCAAGGCTGGTGTGGCCGG - Intronic
1175215297 20:57389325-57389347 GGCCGCTCGGCTGCTGCCGCGGG - Intergenic
1175370214 20:58483262-58483284 CACAGAGCGGCTGGTGCGGAGGG + Intronic
1175873792 20:62220188-62220210 GGCAGCGCGGCTGCTGCAGCGGG + Exonic
1176008129 20:62877195-62877217 CACAGCGCGGCTGCAGGGACAGG - Intergenic
1176163612 20:63661463-63661485 GGCAACGCTGCTGCTGCTGCTGG + Exonic
1180484829 22:15784969-15784991 GACCACGCCGCTGCTGCTGCAGG - Intergenic
1182116886 22:27761762-27761784 GACTGCACTGCTGCAGCGGCCGG - Intronic
1182335527 22:29581031-29581053 GACGGCGCGGCGGCTGCTGGGGG - Exonic
1184101391 22:42343449-42343471 GACAGCGCGGGCGCGGCGGGGGG - Intronic
1184352780 22:43955513-43955535 GACAGAGCGTCTGCTGCTGAGGG - Exonic
1184545336 22:45163768-45163790 CAAAGCGCGGCTGCTGGCGCCGG + Intergenic
949569947 3:5283826-5283848 GACAGGGCGGCTGGCCCGGCGGG + Intergenic
954085536 3:48241255-48241277 GCCTGCGCGGCGCCTGCGGCTGG - Intronic
954106856 3:48414155-48414177 GTCAGCTTTGCTGCTGCGGCTGG - Intronic
957620215 3:82584848-82584870 GACAGGGCGGCTGGCCCGGCAGG - Intergenic
960747805 3:120908773-120908795 GAGAGCGCGGCGGCGGCTGCGGG + Intronic
962301881 3:134250624-134250646 GGCGGCGCGGCTGGGGCGGCCGG - Exonic
965165660 3:165192838-165192860 GCCACCGCGGCGGCAGCGGCAGG - Intronic
967859273 3:194139607-194139629 CACAGCGCGGCTGATGTGTCTGG - Intergenic
968511412 4:997444-997466 GACCGCGCGGCTGCCGGGCCTGG - Intronic
969413374 4:7043529-7043551 GGGGGCGCGGCGGCTGCGGCGGG + Exonic
972690545 4:41393318-41393340 GACAATGTGGCTGCTGCTGCTGG + Intronic
976199086 4:82561778-82561800 TGCAGCGCGGCTGGGGCGGCTGG - Intronic
977162946 4:93659033-93659055 GACAGGGCTGCTGCTGCTACTGG - Intronic
980180364 4:129393502-129393524 GACAGGCCGGCTGCTGCAGCAGG - Intergenic
983323895 4:166228258-166228280 GGCATGCCGGCTGCTGCGGCAGG - Intergenic
984370940 4:178863704-178863726 GACAGGGCGCCTCTTGCGGCAGG - Intergenic
985688730 5:1295290-1295312 GACAGCGCAGCTGCTCCGGGCGG + Intergenic
987035125 5:14011718-14011740 CAGGGCGCGGCGGCTGCGGCGGG - Intergenic
987379930 5:17275607-17275629 GAGAGCGCGGCCCCTGCCGCCGG + Exonic
988727189 5:33937330-33937352 GCCGGGGCGACTGCTGCGGCCGG + Exonic
989261587 5:39424863-39424885 TACAGCGCAGCGGATGCGGCGGG + Exonic
992151559 5:73909591-73909613 GCCAGCGCCGCTGCTCCTGCTGG - Exonic
992950369 5:81852017-81852039 GGGAGCGCGGCAGCCGCGGCGGG - Intergenic
1001060719 5:168486522-168486544 CTCCGCGCGGCTGCTGCAGCAGG + Exonic
1001159570 5:169301067-169301089 GGGAGCGCGGCGGCTGCGGCTGG + Intronic
1002061924 5:176630303-176630325 GATGGAGCGGCGGCTGCGGCGGG + Exonic
1002948513 6:1785635-1785657 GACAGGGCTGGTGCTGAGGCAGG - Intronic
1003290552 6:4775899-4775921 GACGGCGCGGCCGCTGCCGTCGG + Intronic
1004152537 6:13134217-13134239 GACAGGGCGGCTGGCGGGGCGGG - Intronic
1004709517 6:18155982-18156004 GAAAGCGAGGCGGCTGCAGCTGG + Intronic
1004923948 6:20401921-20401943 GGCAGCCCGGGTGCTGCGGCCGG - Intronic
1006436061 6:34026751-34026773 GACACCGCGGGTGCTGTGACAGG - Intronic
1007387224 6:41528150-41528172 GCCACCGCTGCCGCTGCGGCTGG - Intergenic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1010428204 6:75749283-75749305 GACAGGGCGGCGACAGCGGCCGG - Intronic
1010513192 6:76744577-76744599 GACAGGGCGGCTGGCGGGGCAGG - Intergenic
1012475808 6:99613860-99613882 GGCAGCGCGGCGGCTGCGGGCGG - Exonic
1018853856 6:167661938-167661960 GCCTGCGAGGCTGCTGGGGCCGG - Intergenic
1019492388 7:1321491-1321513 GAGAGCGCGGCGCCTACGGCTGG - Intergenic
1020017176 7:4838004-4838026 GACGGCGGGGCTGCTGGCGCTGG - Intronic
1021717721 7:23474377-23474399 GACACCGCCCCTGCTGCGGGCGG + Intergenic
1021849796 7:24796235-24796257 GACAGAGGGGCTCCTGGGGCTGG + Intergenic
1029736850 7:102469828-102469850 GCGAGGGCGGCTGCTGCTGCTGG + Exonic
1030108871 7:106009589-106009611 GTCAGCGCGGCTGCTGGAGGCGG + Intronic
1032649016 7:133857639-133857661 GACACCCCAGCTGCTGCGGCAGG + Intronic
1033235827 7:139637126-139637148 ACCAGCGCCACTGCTGCGGCAGG - Intronic
1034174622 7:149090818-149090840 GACTGAGCGGCAGCCGCGGCCGG - Intergenic
1034413166 7:150951796-150951818 GACTGCGCGGCTGCTGCGGCTGG - Exonic
1035000567 7:155609425-155609447 GACAGGGCTGCTGCTGGGGATGG - Intergenic
1037417821 8:18670249-18670271 CCCAGCGGGGCTGGTGCGGCTGG + Intronic
1039898921 8:41736529-41736551 GACAGCCCGGCAGCTGCTGCTGG + Intronic
1042514351 8:69644100-69644122 TACAGCGTGGCTGCTGAGGGTGG - Intronic
1049114494 8:140674319-140674341 GTCAGCAGGGCTGCTGAGGCTGG + Exonic
1049288583 8:141789949-141789971 GCCAGCGGGGCGGCAGCGGCAGG - Intergenic
1049322320 8:142003089-142003111 GCCAGCGGGGCTGCTGTGGCTGG + Intergenic
1049394242 8:142391729-142391751 GGCATGCCGGCTGCTGCGGCAGG - Intronic
1049654750 8:143792594-143792616 GAGAGCGCAGATGCTGCGGGAGG - Exonic
1049682085 8:143923814-143923836 GTCGGCGCGGCAGCTGCAGCTGG - Exonic
1050350962 9:4741057-4741079 GTCCGCGCGGCTGCTGCGAGCGG - Exonic
1056580481 9:87885720-87885742 GACGGGGCAGCTGCTGTGGCTGG - Exonic
1060336658 9:122730206-122730228 GACACTGCTGCTGCTGCTGCTGG + Intergenic
1062461962 9:136665953-136665975 GGCAGCGCGACCGCTGGGGCCGG + Intronic
1192552942 X:72068538-72068560 CACAGCCAGGCTGCTGGGGCTGG + Intergenic
1194891275 X:99383345-99383367 GACACCCCTGCTGCTGTGGCAGG + Intergenic
1195270227 X:103221253-103221275 GACAGCGCGGCTGTGGGGGCCGG - Intergenic
1195923173 X:110002629-110002651 GCGAGCGCGGCTGCTGCAGGGGG + Intronic
1195938062 X:110143967-110143989 TACAGCAGGGCTGCTGTGGCAGG + Intronic
1200244604 X:154516269-154516291 GACGGCGCAGCTGCTGCCGGGGG - Intergenic
1201282260 Y:12352269-12352291 GACAGGGCGGCTGGTGGGGCGGG - Intergenic