ID: 1150229402

View in Genome Browser
Species Human (GRCh38)
Location 17:63541896-63541918
Sequence GAGACAGATGTTGAGCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150229393_1150229402 27 Left 1150229393 17:63541846-63541868 CCCTGCACCCTGCTCCACAGCAC 0: 1
1: 1
2: 5
3: 36
4: 425
Right 1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 176
1150229399_1150229402 13 Left 1150229399 17:63541860-63541882 CCACAGCACTGGCAGGCCAAGCA 0: 1
1: 0
2: 2
3: 28
4: 326
Right 1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 176
1150229401_1150229402 -3 Left 1150229401 17:63541876-63541898 CCAAGCAGCAGGAAGACGTTGAG 0: 1
1: 0
2: 1
3: 23
4: 191
Right 1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 176
1150229394_1150229402 26 Left 1150229394 17:63541847-63541869 CCTGCACCCTGCTCCACAGCACT 0: 1
1: 0
2: 5
3: 37
4: 386
Right 1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 176
1150229396_1150229402 20 Left 1150229396 17:63541853-63541875 CCCTGCTCCACAGCACTGGCAGG 0: 1
1: 1
2: 2
3: 32
4: 767
Right 1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 176
1150229398_1150229402 19 Left 1150229398 17:63541854-63541876 CCTGCTCCACAGCACTGGCAGGC 0: 1
1: 0
2: 2
3: 25
4: 302
Right 1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150229402 Original CRISPR GAGACAGATGTTGAGCCTTT AGG Intronic
901173975 1:7285102-7285124 GAGAGAGATGTTCAGCCTGATGG + Intronic
902305854 1:15538529-15538551 GAGACAGAGTTTCAGCATTTTGG - Intronic
903376638 1:22870508-22870530 GGGACAGAGGCTGAGCCTTAGGG + Intronic
903813635 1:26048607-26048629 GAGAGAGCAGTTGAGACTTTGGG - Intergenic
905491905 1:38350966-38350988 GAAGCAGATCATGAGCCTTTAGG - Intergenic
907283879 1:53368101-53368123 GAGATAGACATTGAGTCTTTTGG - Intergenic
908613484 1:65889639-65889661 CAGACAGATGTTGAGTTATTTGG - Intronic
910883042 1:91939669-91939691 GAGACAGAGTTTGACCATTTTGG + Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917954543 1:180080523-180080545 GACACAGATGTGCAGCTTTTGGG - Exonic
917965795 1:180177741-180177763 AAAAGAGGTGTTGAGCCTTTAGG - Intronic
918301360 1:183207134-183207156 GAGAGAGATGATGGGCCTTCAGG - Intronic
919749416 1:201027442-201027464 ACCACAGATGTTTAGCCTTTGGG - Intergenic
922060935 1:222090776-222090798 GAGTCACATGTTGTGCCTTTAGG - Intergenic
922329714 1:224563680-224563702 GGGACAGATGTTGTGTCTTAGGG + Intronic
924183987 1:241467426-241467448 GAGAGAGAAGTTGTGACTTTGGG + Intergenic
924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG + Intergenic
1062989344 10:1800763-1800785 CAGACACATGTTGAGCCGTGGGG + Intergenic
1063137884 10:3233024-3233046 GAGACAGTTTGTGAGCCTTGAGG + Intergenic
1064953868 10:20884930-20884952 GAGAGAGATGTAGAGTTTTTAGG - Intronic
1067750743 10:48969593-48969615 AGGACACATGTTGAGCATTTGGG + Intronic
1068398681 10:56499293-56499315 GAGACAGACAGTGAGACTTTGGG + Intergenic
1070837848 10:79461983-79462005 GGGGCACATGTAGAGCCTTTTGG + Intergenic
1072823404 10:98581277-98581299 TAGCCAGATGTTGAGCTCTTGGG - Intronic
1074750722 10:116583932-116583954 TATACAAATTTTGAGCCTTTGGG + Intergenic
1079079407 11:17403534-17403556 TATACAAATGTTGATCCTTTGGG + Intronic
1081004923 11:37724422-37724444 GAGACAGATGAAGGGACTTTAGG - Intergenic
1082825411 11:57574161-57574183 GAGACTGAGGCTGAGCCTGTTGG - Intergenic
1085361821 11:75895371-75895393 CAGAAAGATGTAAAGCCTTTGGG - Intronic
1085750823 11:79159638-79159660 GACCCAGATGTTGAGCCTCTAGG + Intronic
1087366276 11:97223710-97223732 GAGAGTGATCTTGAGCCCTTGGG + Intergenic
1090427868 11:126622230-126622252 GAGAAAGTTGTTGCACCTTTGGG + Intronic
1090523711 11:127506174-127506196 CAGACAGAGGTTGACCTTTTAGG - Intergenic
1092436373 12:8449624-8449646 GAGACAGAAATTGAGCATTCAGG - Intergenic
1096438511 12:51617228-51617250 GATACAAATGTTAAGTCTTTTGG + Intronic
1097400496 12:59122840-59122862 GAAACAGATGTGTTGCCTTTTGG - Intergenic
1100391124 12:94147445-94147467 GAGACAGATGGAGAGCCTCGAGG + Intergenic
1102721020 12:115016194-115016216 GAGAGAGATTTTGAGCCTAAGGG + Intergenic
1102935373 12:116892085-116892107 GTGACAGCTTTTGAGTCTTTGGG + Intergenic
1105258687 13:18762748-18762770 GAGACAGAGGTAGATCCTCTTGG + Intergenic
1105572798 13:21619984-21620006 GAGATAGATGTTAATCCATTTGG - Intergenic
1105622903 13:22086544-22086566 GAGACAAATGATGAGCCTGGAGG + Intergenic
1105657363 13:22455630-22455652 GAGCCAGCTGTTCAGCATTTTGG + Intergenic
1114999830 14:28408769-28408791 GAAGGAGATGTTGAGCATTTAGG - Intergenic
1116692993 14:48134836-48134858 GAGACAGATTTTCACCATTTTGG - Intergenic
1118008067 14:61583103-61583125 GAAAGAGATGTTGAGCATTATGG - Intronic
1118126419 14:62909512-62909534 GAGAGAGAGGTTGAGGTTTTTGG - Intronic
1118566546 14:67147287-67147309 GAGACAGATTTAGAGCATTAGGG - Intronic
1119746257 14:77046363-77046385 GAGACAGAAGTTGCTCCTTAAGG + Intergenic
1119935032 14:78584468-78584490 GACAATGATGTTCAGCCTTTGGG - Intronic
1120732356 14:88017943-88017965 GAGACAAATGTTGATCCTCATGG + Intergenic
1125112461 15:36049151-36049173 GAGACAGCTGTTTAGTATTTTGG - Intergenic
1126695262 15:51320574-51320596 GAGACAGCTTTTGGGCCTCTTGG - Intronic
1127863034 15:63010310-63010332 GAGAGAGTTGATGATCCTTTTGG - Intergenic
1128036275 15:64529301-64529323 GACAGAGATGTTGACCCTTTTGG + Intronic
1128777628 15:70335681-70335703 GAGACAGAGGCTCAGCCTGTGGG + Intergenic
1132248747 15:100317628-100317650 GGAACAAATGTTGAGCATTTTGG + Intronic
1132741691 16:1416796-1416818 GAAACAGATTTGGAGCCTTAGGG + Intergenic
1134634199 16:15779728-15779750 GAGATACTTGTTGAGCCTCTAGG - Intronic
1139208461 16:65052458-65052480 GAGAGAGATTATGAGGCTTTGGG + Intronic
1139624628 16:68176334-68176356 AAAAAAGATGTTGAGCATTTAGG - Intronic
1139676631 16:68528465-68528487 AAGAGAGATGCTGAGCCTTCAGG + Intergenic
1143302709 17:5922640-5922662 GTGACAGGTGTTGTGGCTTTGGG - Intronic
1144636079 17:16910034-16910056 GAGACAGATGTGGAAGCTCTCGG - Intergenic
1145871134 17:28274320-28274342 GAGACAGATGGTTAGAATTTAGG - Intergenic
1148115788 17:45173928-45173950 GAGACAGAGTTTCAGCCTGTTGG + Intergenic
1148226352 17:45900380-45900402 GAGACAGGTTTTGAGCTTTCTGG + Intronic
1148805547 17:50262083-50262105 TAGAAAGATGTTGAGCCTTCTGG - Intergenic
1149497073 17:57125763-57125785 GAAACAAACATTGAGCCTTTAGG + Intergenic
1149650320 17:58272475-58272497 GAGACAGATTTTCAGACTGTGGG + Intronic
1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG + Intronic
1153374200 18:4357033-4357055 CAGACAGATGATGAGTCCTTTGG - Intronic
1155133697 18:22965768-22965790 GAACCAATTGTTGAGCCTTTTGG + Intronic
1155374062 18:25136994-25137016 GAGACAGAGGAGGATCCTTTTGG - Intronic
1157665018 18:49478701-49478723 CAGACAGATGTTGATATTTTAGG + Intronic
1159133397 18:64307317-64307339 GAAACATATGTTCAGCCCTTAGG - Intergenic
1160575907 18:79853760-79853782 AGCACAGATGTTGAGGCTTTGGG - Intergenic
1161834904 19:6639284-6639306 GAGAAGGGTTTTGAGCCTTTGGG - Intergenic
1164005180 19:21142097-21142119 GCCACAGATGTTGGGCCTCTAGG - Exonic
1165444378 19:35848868-35848890 GAGACAGATGCTGAGATCTTTGG + Intronic
1166751319 19:45165173-45165195 GGGACAGAAGATGAGCCTGTCGG - Exonic
1166795314 19:45422224-45422246 GGGACAGATCTAGAGCCTTGTGG - Intronic
1167125776 19:47547500-47547522 GAGGCTGAGGGTGAGCCTTTGGG - Intronic
927406562 2:22776959-22776981 GTGAAAGATGTTTACCCTTTAGG + Intergenic
928756109 2:34527608-34527630 GGGACATATTTTGAGCATTTTGG + Intergenic
929961010 2:46496392-46496414 GAGACAGATCTGAGGCCTTTTGG - Intronic
930725196 2:54675256-54675278 GAAACAGAAGTAGCGCCTTTTGG - Intergenic
932212029 2:69939791-69939813 GAGTCAGCCGTTGAGCCCTTAGG - Exonic
937587989 2:123579413-123579435 GAGAAAGATGATGATCCTATAGG + Intergenic
938075320 2:128329592-128329614 GTCACAGATGTTGAACATTTAGG + Intergenic
939531481 2:143368003-143368025 GAGAGAGATGTTTAGACCTTTGG + Intronic
939598626 2:144160507-144160529 GAGACAGATTTTGGAACTTTTGG + Intronic
942432444 2:175926996-175927018 GAGACAGATGGTAAGTCCTTTGG + Exonic
945816832 2:214615115-214615137 TAGACAGATGTTGTGCCTTCTGG - Intergenic
947819209 2:233059023-233059045 GTGACACATGTTGAGCCCCTGGG + Intergenic
1169285900 20:4306883-4306905 GAGACATTTGTTGAAGCTTTCGG + Intergenic
1172526478 20:35602894-35602916 GAGCCAGATGCTGGGCCTATGGG - Intergenic
1172567464 20:35941890-35941912 GAGACTGAAGTTGAGCTTTAAGG + Intronic
1172752458 20:37260175-37260197 GTGGCAAATGTTGAGCCTCTTGG - Intronic
1172999191 20:39093323-39093345 GACACAGATGTTGGGCCTCGTGG - Intergenic
1174762049 20:53215977-53215999 GAGACAGGTGTTTGGCCTTAGGG - Intronic
1176418789 21:6498153-6498175 AAGCCAGATGCTGAGTCTTTAGG + Intergenic
1177155272 21:17494927-17494949 GAGACAGATGGTGAAAATTTGGG + Intergenic
1177522894 21:22253059-22253081 GAGCCAGAAGGTGAGTCTTTTGG - Intergenic
1178867201 21:36338931-36338953 GACATAGATGTTGACCGTTTGGG + Intronic
1179275362 21:39887225-39887247 GAGGCAGAATTTCAGCCTTTGGG + Intronic
1179694283 21:43106475-43106497 AAGCCAGATGCTGAGTCTTTAGG + Intronic
1181511467 22:23391018-23391040 CAGTCAGATGTTGGGCCTTTTGG - Intergenic
950368979 3:12511441-12511463 GAGACAGCTGATTAGCCATTTGG + Intronic
952387819 3:32855573-32855595 GAGACAGATCCTCAGCCTGTCGG + Intronic
956609040 3:71103444-71103466 GAGACAGAGGTTGTGCATATAGG - Intronic
956729191 3:72181178-72181200 GAGACAAATGTTGAGTCTGCTGG - Intergenic
957436339 3:80181887-80181909 GAGGCACATTTTGAGCCCTTGGG - Intergenic
959970777 3:112407216-112407238 GAGACAGAAATTGTGCATTTGGG - Intergenic
961377076 3:126474382-126474404 GAGACAGAGGCCGAGCCTTGTGG - Intronic
966439493 3:179928199-179928221 AAGCCAGATTGTGAGCCTTTGGG + Intronic
971155251 4:24074818-24074840 GAGAGAGATGTTTAGGTTTTTGG + Intergenic
972844151 4:42967770-42967792 TAGAAAGAGTTTGAGCCTTTGGG + Intronic
975561759 4:75715041-75715063 TAGACAGATGTTGCCACTTTTGG - Intronic
975973364 4:80069059-80069081 GAGAAAGATATGGATCCTTTTGG - Intronic
976627979 4:87207431-87207453 GGGAGAGATGATGACCCTTTTGG - Intronic
979698311 4:123639241-123639263 GAGACAGATGTGGGTCATTTTGG + Intergenic
983777057 4:171621443-171621465 GAAACAGATGGTTAGCCTCTGGG + Intergenic
983893410 4:173055780-173055802 GAAACAGATTTTCAGCCTTCTGG - Intergenic
984729857 4:183057820-183057842 GAGCTAGATGTTCACCCTTTGGG - Intergenic
986216253 5:5721893-5721915 GAGACAGAGGTGAACCCTTTGGG + Intergenic
986794437 5:11195028-11195050 TAGTCAGATTTTGAGCCTCTTGG - Intronic
987029805 5:13965120-13965142 GAAACACATGTTGACCCTCTAGG - Intergenic
987164670 5:15183669-15183691 GAGCCAGATCTTGAGCTTTCTGG - Intergenic
988043356 5:25916040-25916062 GTTAGTGATGTTGAGCCTTTTGG - Intergenic
989527176 5:42467000-42467022 CAGACAGAGGTTGAGCCTCACGG - Intronic
991328626 5:65466206-65466228 GAGCCAGATGTAAAGGCTTTAGG - Intronic
992737013 5:79732054-79732076 GATACAGATGTTGAGGTTGTTGG - Exonic
993227208 5:85182454-85182476 GAGACAGCTGTACAGCCCTTTGG + Intergenic
993408535 5:87544831-87544853 TAGAAAGATGGGGAGCCTTTGGG - Intergenic
995945284 5:117637646-117637668 GAGACAGATGTCAAAGCTTTGGG + Intergenic
996506347 5:124271535-124271557 GAGACAGATTTTAAGTCTTCTGG + Intergenic
996978613 5:129462039-129462061 CAGAAAGAAGTTGAGCCATTGGG - Intronic
997043390 5:130283651-130283673 GAGACGGAAATTCAGCCTTTCGG + Intergenic
998482940 5:142478044-142478066 GAGACAGACATTGAGGGTTTAGG - Intergenic
1003306345 6:4932685-4932707 GAGACAGACGTGGAGACTCTGGG - Intronic
1003882314 6:10489973-10489995 AAAAAAAATGTTGAGCCTTTGGG - Intergenic
1004153566 6:13145771-13145793 GATAAAGATCTTGACCCTTTTGG - Intronic
1006954125 6:37851758-37851780 GGGACAGATTTTCAGCCATTAGG + Intronic
1007722568 6:43893892-43893914 GAGAGAGAAGCTGAGCCTATGGG - Intergenic
1008215526 6:48783178-48783200 GAGATAGATGTTCTGACTTTGGG + Intergenic
1010214939 6:73393300-73393322 CAGACTGATGTTGAACCTTGGGG + Intronic
1011280843 6:85675944-85675966 GAGACAAATATTGAGGATTTGGG - Intergenic
1013456112 6:110330955-110330977 GATACAGATGTTGAAATTTTTGG + Intronic
1017562199 6:155640352-155640374 GAGACAGAGGGTTATCCTTTTGG - Intergenic
1018372034 6:163177360-163177382 GAGACAGAAGATGAGCCTGAGGG + Intronic
1019971357 7:4543443-4543465 GAGACTGAGGTTGAGCCTCCTGG - Intergenic
1022059849 7:26782698-26782720 GAAAAAGAGGTGGAGCCTTTGGG + Intronic
1023525920 7:41102873-41102895 TATTCAGATGTTGAGCCTTCTGG - Intergenic
1025766835 7:64463923-64463945 GACACAGAGGTTGGGCCTCTAGG - Intergenic
1026015182 7:66666604-66666626 GGGGCAGATGTTGAGCCTCTGGG + Intronic
1026891579 7:73985741-73985763 AGGGCAGATGTTGAGCCTCTGGG + Intergenic
1031459601 7:122030647-122030669 GCAACAGATGTTCAGCATTTAGG - Intronic
1036058783 8:5290993-5291015 AACACAGAGGTTGGGCCTTTTGG - Intergenic
1037862724 8:22417304-22417326 GAGAAAGATTTTCAGCCTTTAGG + Intronic
1038942728 8:32323403-32323425 GAGACTGATTTAGAGCCTATAGG + Intronic
1039508717 8:38071781-38071803 GTGATAGATGTGGAGGCTTTGGG + Intergenic
1041272021 8:56118086-56118108 GAGACTGCTGTTGAGCTTCTGGG - Intergenic
1041924357 8:63221422-63221444 GAGACAGAGTTTCAGCCTGTAGG + Intergenic
1045035764 8:98175516-98175538 GAGACTGGACTTGAGCCTTTGGG + Intergenic
1045655236 8:104380078-104380100 GACAAAAATGTTGAGACTTTGGG + Intronic
1047383861 8:124390249-124390271 GAGAAAAATGATGAGTCTTTAGG + Intergenic
1048458258 8:134598013-134598035 GAGGCAGATGTTGTGCCGTGAGG - Intronic
1048838686 8:138545991-138546013 GAAACAGCTGGTGAGCCTTTGGG + Intergenic
1048952766 8:139509846-139509868 GAGTGAGGTGTTCAGCCTTTAGG - Intergenic
1050686935 9:8182101-8182123 GAGAGAGATGTTGCGTTTTTTGG - Intergenic
1050737559 9:8781300-8781322 GAGACAGCTTTTAAGCCTTCTGG - Intronic
1050855647 9:10350854-10350876 GAGACAGGTGTTTGGCCTTATGG + Intronic
1053663702 9:40302277-40302299 GAGACAGAGGCAGAGCCTCTTGG - Intronic
1053914217 9:42932819-42932841 GAGACAGAGGCAGAGCCTCTTGG - Intergenic
1054375828 9:64448510-64448532 GAGACAGAGGCAGAGCCTCTTGG - Intergenic
1054520911 9:66074008-66074030 GAGACAGAGGCAGAGCCTCTTGG + Intergenic
1056349070 9:85730180-85730202 GAGACATAGGTTGAGCTTTAAGG - Intronic
1059053006 9:110948803-110948825 GAAACAGAAGATGAGCCCTTGGG + Intronic
1060865388 9:126991083-126991105 TAGACAGCTGTTTAGCCTTTGGG - Intronic
1061737459 9:132670927-132670949 GAGACAGCTGTTGAGCGGTGCGG - Exonic
1185876517 X:3706397-3706419 CAGACAGATCTTGAGCTCTTGGG + Intronic
1190296003 X:49028155-49028177 GGAACAGATGTTGAGATTTTGGG - Intergenic
1193597849 X:83469616-83469638 GAGACAGATGCTAATCCCTTAGG - Intergenic
1193640591 X:84006153-84006175 CAGACAGAGGTTGAGCCATCAGG - Intergenic
1201702259 Y:16897141-16897163 GAGATAGATGTTAAATCTTTTGG + Intergenic
1201943944 Y:19490197-19490219 GAGACTGATTTAGAGTCTTTAGG + Intergenic