ID: 1150230549

View in Genome Browser
Species Human (GRCh38)
Location 17:63547491-63547513
Sequence TGTGTTTTTAAAATAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3314
Summary {0: 1, 1: 0, 2: 13, 3: 253, 4: 3047}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150230549 Original CRISPR TGTGTTTTTAAAATAGATGG TGG (reversed) Intronic
Too many off-targets to display for this crispr