ID: 1150237773

View in Genome Browser
Species Human (GRCh38)
Location 17:63606897-63606919
Sequence TGCTAGTAGAAACTACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150237773_1150237775 1 Left 1150237773 17:63606897-63606919 CCTTAATGTAGTTTCTACTAGCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1150237775 17:63606921-63606943 GATCCCAAAGACTTGTTCATCGG 0: 1
1: 1
2: 0
3: 4
4: 96
1150237773_1150237780 13 Left 1150237773 17:63606897-63606919 CCTTAATGTAGTTTCTACTAGCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1150237780 17:63606933-63606955 TTGTTCATCGGATGTAGAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 93
1150237773_1150237778 11 Left 1150237773 17:63606897-63606919 CCTTAATGTAGTTTCTACTAGCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1150237778 17:63606931-63606953 ACTTGTTCATCGGATGTAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 66
1150237773_1150237779 12 Left 1150237773 17:63606897-63606919 CCTTAATGTAGTTTCTACTAGCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1150237779 17:63606932-63606954 CTTGTTCATCGGATGTAGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150237773 Original CRISPR TGCTAGTAGAAACTACATTA AGG (reversed) Intronic
905714458 1:40136113-40136135 AACTAGTAGAAACTACATCATGG - Intergenic
911547304 1:99233833-99233855 TGATAGTAGAAAATACAAGAAGG - Intergenic
912252297 1:108024195-108024217 TTATATTAGAAACTAAATTAAGG + Intergenic
912856290 1:113171270-113171292 TGGCAGCAGAAACTGCATTATGG - Intergenic
915938034 1:160100188-160100210 TGCCAGTAGAAGCCACATTGAGG + Intergenic
918782170 1:188714849-188714871 TTCTAGAAGAAACTCCATTAAGG + Intergenic
919423561 1:197402865-197402887 TGCTATTAAAATCTACATTGGGG - Intronic
919541645 1:198853927-198853949 TGCAAGTTTAAACTACATTAAGG + Intergenic
921391471 1:214619010-214619032 TCTTAGTAGAAACAACATTTTGG - Intronic
1063681007 10:8188033-8188055 TGCTCATAGAAACAACATAATGG + Intergenic
1068183409 10:53552114-53552136 TTCTACTGGAAACTTCATTATGG - Intergenic
1068637839 10:59367553-59367575 TGATAGGAGAAACTAACTTAGGG - Intergenic
1075074030 10:119338432-119338454 AGCTAGAAGAAATTACATGAAGG - Intronic
1077935504 11:6781492-6781514 TGCTAGTAGATACAAGAATATGG + Intergenic
1078838981 11:15060041-15060063 TTCTAGTATAAACTCTATTAAGG + Intronic
1079680513 11:23290884-23290906 TTCTATTAGAAACTATGTTAGGG + Intergenic
1085422696 11:76377557-76377579 TGCCAGTACATACTACAGTATGG - Intronic
1086209228 11:84298044-84298066 TGCTATTACAAATTAAATTATGG - Intronic
1087366665 11:97228547-97228569 TGACAGTAGCAACTACATCATGG + Intergenic
1088115949 11:106314153-106314175 TCAAAGTAGAAATTACATTATGG - Intergenic
1088215761 11:107507122-107507144 TGTAATTATAAACTACATTATGG + Intronic
1090983460 11:131745129-131745151 TGCTACCAGAAACCACTTTATGG + Intronic
1091960623 12:4691167-4691189 TGATAGTAATAACTACATGATGG + Exonic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094051976 12:26230133-26230155 TGCTGGGAGAAAATAAATTATGG - Intronic
1094567906 12:31616640-31616662 TGATAATAGGACCTACATTAGGG + Intergenic
1095200370 12:39377447-39377469 AGTTAGTAGATACCACATTAAGG + Intronic
1095204419 12:39423274-39423296 AGATACTGGAAACTACATTAGGG - Intronic
1095205326 12:39433049-39433071 TGCTAGTAGTAATTGTATTAGGG + Intronic
1102666656 12:114580015-114580037 TGCAAGAAGAAACTGCATTCAGG + Intergenic
1107529829 13:41272750-41272772 TGCGAGTTCAAACTACATAAAGG + Intergenic
1107554121 13:41502533-41502555 TGCTAGGATAAACAACCTTATGG - Intergenic
1107900014 13:45002494-45002516 TGCTAGTACAGGCTACAATAAGG - Intronic
1108094157 13:46882902-46882924 TGGTAACAGAACCTACATTATGG - Intronic
1109631118 13:65047745-65047767 AGCTAGTGGAAAAGACATTAGGG + Intergenic
1114201312 14:20523403-20523425 TGCTTTTAGAAACTACAAGATGG + Intergenic
1114990890 14:28287864-28287886 TGCTAAGAAAAACTGCATTATGG - Intergenic
1115018295 14:28643456-28643478 TGCTTTTAGAAATTACATAATGG + Intergenic
1120326174 14:83030077-83030099 TGCTAGTAGAAACATCTTTTTGG - Intergenic
1125067111 15:35500686-35500708 TTCTAATAGAAACAAAATTATGG - Intronic
1126320950 15:47422557-47422579 TGCTAGAAGAAACTTCAATGAGG + Intronic
1129929824 15:79401498-79401520 TGCTAGTAGCAACTCCAATGTGG - Intronic
1137349565 16:47700414-47700436 TACTAGTAAAAACAACATTAAGG + Intronic
1138058452 16:53861794-53861816 TATTATTAGAAACTACATTTTGG - Intronic
1138250882 16:55501010-55501032 TTCTACTATAAACTACATGAGGG - Intronic
1139079738 16:63501842-63501864 TACTTGTAGAATTTACATTATGG - Intergenic
1142066080 16:88063728-88063750 TGCTGGCAGAAACAACATCACGG - Intronic
1146588612 17:34106866-34106888 TGGTAGTAGAGACAAAATTATGG + Intronic
1146982657 17:37179829-37179851 TTCTAGTAGAAGCTTCATTCTGG - Intronic
1148260565 17:46179512-46179534 GGTTAGTAGAAGCCACATTATGG - Intronic
1150237773 17:63606897-63606919 TGCTAGTAGAAACTACATTAAGG - Intronic
1154289061 18:13090182-13090204 TGCTATTATAAACAACACTATGG - Intronic
1156929097 18:42619121-42619143 TGCTAATAGAAAATACTTCAAGG + Intergenic
1157512998 18:48291864-48291886 TGCTAGGAGAGACTCCAATAGGG + Intronic
1159418701 18:68186171-68186193 TTCTTGTAGAAACAATATTAGGG - Intergenic
1160138175 18:76292746-76292768 TGCTAGGAGACACTTTATTATGG + Intergenic
1161173762 19:2827482-2827504 AGCTAGTAGAAACTGACTTATGG + Intronic
1162134828 19:8548921-8548943 TGATAATAGCAACTACCTTATGG + Intronic
926079587 2:9973605-9973627 AGTTAGAATAAACTACATTATGG + Intronic
926620743 2:15044968-15044990 TGCTAATAGAAACTCCCTAAGGG + Intergenic
926828719 2:16936366-16936388 TGCTTGTAAAAACTAGATTTGGG + Intergenic
927062637 2:19438786-19438808 TGCCAGAAGAAACGACAGTAAGG + Intergenic
940540683 2:155011654-155011676 TGCTATTTGATACTACAGTAGGG + Intergenic
944590507 2:201212812-201212834 TGCTACTAGAATAAACATTATGG + Intronic
946704264 2:222442700-222442722 TGCAAAAAGAAACTACATTTTGG - Intronic
947048180 2:226012341-226012363 TGCTAATTGAAACCACATCATGG - Intergenic
948876280 2:240831387-240831409 TACTAATAAATACTACATTAGGG + Intergenic
1169314088 20:4573750-4573772 TGGTAGAAGATACTACACTAAGG + Intergenic
1169469637 20:5872674-5872696 TGCTTACTGAAACTACATTATGG - Intergenic
1170310613 20:14987279-14987301 TGATAGTAAAATCTACCTTATGG + Intronic
1170919619 20:20665231-20665253 AGATGGTAGAAACTGCATTAGGG - Intronic
1173314165 20:41928623-41928645 TGCTAGTATACACTACAACATGG - Intergenic
1174954135 20:55077495-55077517 TACTAGTAGAAATTAGATAAGGG - Intergenic
949591535 3:5499396-5499418 TGCTAGAGGAAAATAAATTAAGG - Intergenic
951083866 3:18486722-18486744 TACTAGTAGAATTTACAATAAGG + Intergenic
952603803 3:35118913-35118935 TTCTAGGAGAATCTACATTAAGG + Intergenic
953621971 3:44541309-44541331 CTCTAGTAGAAACTACTCTATGG - Intergenic
955316658 3:57944885-57944907 TGCCAGTAAACACTATATTAGGG - Intergenic
957105309 3:75880052-75880074 GGCTAGTAAAAACAATATTAGGG - Intergenic
957369826 3:79279085-79279107 TTTTAGTAGAAACTACATGTTGG - Intronic
957418641 3:79938726-79938748 TGCTAGTAGAAGAAACTTTAAGG - Intergenic
957607432 3:82420106-82420128 TGCTACTAGAAATTACATTTTGG + Intergenic
959762448 3:109982413-109982435 TGCTTGGAGAAACTGCATTCAGG + Intergenic
964912089 3:161795266-161795288 TGCTAAAATAACCTACATTAGGG + Intergenic
965610876 3:170542837-170542859 TAGTAGTAGAAACCACGTTAAGG - Intronic
966277389 3:178190852-178190874 TGCTAGTAGAATCTAAAATGTGG + Intergenic
967446996 3:189578396-189578418 TGGTAGGAAAAACTACAGTATGG + Intergenic
967790775 3:193546669-193546691 TGATGGTAGAAAAAACATTAGGG - Intronic
970905088 4:21206405-21206427 TAATAGTTGAAAATACATTATGG + Intronic
973729604 4:53810846-53810868 TGCTTCTAGAAAGTACATTAGGG + Intronic
977422471 4:96819657-96819679 TGATAGTAAACACTGCATTATGG + Intergenic
979011957 4:115383013-115383035 TGCTATTAGAAACTTCATGAGGG + Intergenic
981356316 4:143793100-143793122 TGCAAATCCAAACTACATTAGGG - Intergenic
981491352 4:145343634-145343656 GGCTAGTAGAAGCTAAATTCAGG - Intergenic
982947863 4:161648756-161648778 TGCTAATAGAACCTACATTTAGG - Intronic
983042885 4:162951464-162951486 TGGAATTAGAAAGTACATTATGG + Intergenic
991691185 5:69226544-69226566 TGCAAGTAGAAATTAACTTATGG + Intronic
997701699 5:135906515-135906537 TTCTAGTGGAAACTGCATTTGGG - Intergenic
1002016006 5:176323374-176323396 TGTTAGTAGAAATAACAATAGGG + Intronic
1002270862 5:178071017-178071039 TGCAAGTTGAAACTACAATGGGG - Intergenic
1006381632 6:33701584-33701606 TGCTATTAGAAACTACTTTTTGG + Intronic
1008202170 6:48603951-48603973 TGCAAGTAGAAAGTTCATTAGGG + Intergenic
1008315630 6:50036680-50036702 TGCTGGTATAAAATAAATTAAGG + Intergenic
1008431787 6:51426742-51426764 TGGTAATAGAAACTAAAATATGG - Intergenic
1013026214 6:106275257-106275279 TGCTTGTAGAAAATATATTTTGG - Intronic
1013965112 6:115946353-115946375 TGATAATAGTAACTACTTTATGG + Intronic
1017797513 6:157859489-157859511 TGTTAGTAGAAGCTATATTGGGG + Intronic
1018305747 6:162453393-162453415 ATTTAGTAGAAACCACATTAAGG + Intronic
1021145403 7:17082672-17082694 TTCTTGTAGAAACTATATTTGGG + Intergenic
1026492910 7:70878596-70878618 CACTAGTAGAAACTGCATTTTGG + Intergenic
1027808892 7:82866899-82866921 TGCTCTTAGAAACTACCTGAAGG + Intronic
1028425532 7:90683497-90683519 TGCTATTAGAAACCAAATTCTGG + Intronic
1028885475 7:95928053-95928075 TGCTATCAGACCCTACATTATGG + Intronic
1030674686 7:112372147-112372169 TGCTAATACATACTACAATATGG + Intergenic
1031868511 7:127066386-127066408 TGCAATTATAAACCACATTATGG + Intronic
1033899156 7:146115564-146115586 TGCCAGGAGAAACTACACTTAGG - Intergenic
1038414748 8:27386495-27386517 TGCTAATAAAAACAACTTTAAGG - Intronic
1041055365 8:53980169-53980191 TGCTATTAGAAACTATAATCTGG - Intronic
1042064809 8:64862857-64862879 TGCTCCTAATAACTACATTAGGG - Intergenic
1044648620 8:94470791-94470813 TGCTAGTATCAATTACAGTAGGG + Intronic
1044773970 8:95668462-95668484 TGCTATGAAAAAATACATTAAGG - Intergenic
1045200102 8:99971884-99971906 AGCTAGAAAAAACTACTTTAAGG + Intronic
1045825833 8:106396818-106396840 TGTTAGGAGAAACTAGATGAAGG + Intronic
1050534634 9:6621198-6621220 TGCTGGTAGAAACTGCATAAGGG - Intronic
1052723909 9:32206503-32206525 TACTAGTAGCATCTACATTTTGG + Intergenic
1059610996 9:115894821-115894843 TGATAGTAGAAATTAATTTAAGG - Intergenic
1059804469 9:117783708-117783730 TGCTTGGATAAACTACATTCAGG - Intergenic
1062728619 9:138095788-138095810 TACTAATAGATACTACAATATGG + Intronic
1187326018 X:18289499-18289521 TTTTATTATAAACTACATTAAGG + Intronic
1188690458 X:33122618-33122640 TGTTATTTGAAAATACATTATGG - Intronic
1193975592 X:88114628-88114650 TGATAGTAGAAACTGTATAAAGG + Intergenic
1199343639 X:146712328-146712350 TCCTAGTAGAAATCACATTCTGG - Intergenic
1199748275 X:150790175-150790197 CGCTAATAGAAACTAGACTAGGG + Intronic
1202188944 Y:22221041-22221063 TGCTAGTAGAAATTATTTTCTGG - Intergenic
1202239807 Y:22754828-22754850 TGCTAGTAGAAATTATTTTCTGG + Intergenic
1202392793 Y:24388590-24388612 TGCTAGTAGAAATTATTTTCTGG + Intergenic
1202477990 Y:25281527-25281549 TGCTAGTAGAAATTATTTTCTGG - Intergenic